Previous Contig 002363:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN010F17Sequence626002363 (2)pir|T51842|T518421e-38RING-H2 finger protein RHA2a [imported] - Arabidopsis thaliana>gb:AE005172_89050
JMFN015B09Sequence620002363 (2)pir|T51842|T518429e-39RING-H2 finger protein RHA2a [imported] - Arabidopsis thaliana>gb:AE005172_89050

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN015B09+ AAAAAGGTAAATAATTCCCTGAAAAAAGGAAATAAAATTTAAACAAA
                      ____________________________________________________________
consensus AAAAAGGTAAATAATTCCCTGAAAAAAGGAAATAAAATTTAAACAAA
 
. : . : . : . : . : . :
JMFN015B09+ AAAAAAAAAAAAAGTTCAGAAGTCATAAACGCATCATCAAGATATCAACAACTACTGCAA
JMFN010F17+ CATCAAGATATCAACAACTACTGCAA
                      ____________________________________________________________
consensus AAAAAAAAAAAAAGTTCAGAAGTCATAAACGCATCATCAAGATATCAACAACTACTGCAA
 
. : . : . : . : . : . :
JMFN015B09+ TCATAGCCGCACATCATCGCAAGGAGAACCAGGCCAACACGTCTCCGGCAACGCGCTGGC
JMFN010F17+ TCATAGCCGCACATCATCGCAAGGAGAACCAGGCCAACACGTCTCCGGCAACGCGCTGGC
                      ____________________________________________________________
consensus TCATAGCCGCACATCATCGCAAGGAGAACCAGGCCAACACGTCTCCGGCAACGCGCTGGC
 
. : . : . : . : . : . :
JMFN015B09+ GCGTGAGGGAGACGCTCTCATCGGAGACGAGCGGAGACCGGCAGAGAGGGCAATTGAACT
JMFN010F17+ GCGTGAGGGAGACGCTCTCATCGGAGACGAGCGGAGACCGGCAGAGAGGGCAATTGAACT
                      ____________________________________________________________
consensus GCGTGAGGGAGACGCTCTCATCGGAGACGAGCGGAGACCGGCAGAGAGGGCAATTGAACT
 
. : . : . : . : . : . :
JMFN015B09+ TGAGCTGGTCAAGCCAGCCATCGAAGCACTCCTTATGGAAGACGTGCCTGCAGTCCAGCT
JMFN010F17+ TGAGCTGGTCAAGCCAGCCATCGAAGCACTCCTTATGGAAGACGTGCCTGCAGTCCAGCT
                      ____________________________________________________________
consensus TGAGCTGGTCAAGCCAGCCATCGAAGCACTCCTTATGGAAGACGTGCCTGCAGTCCAGCT
 
. : . : . : . : . : . :
JMFN015B09+ TCCGGACGTGGTCGCCGTCGCCGAGGCGGTCGAGGCAAACGACGCAGTTAGGACCGGCTC
JMFN010F17+ TCCGGACGTGGTCGCCGTCGCCGAGGCGGTCGAGGCAAACGACGCAGTTAGGACCGGCTC
                      ____________________________________________________________
consensus TCCGGACGTGGTCGCCGTCGCCGAGGCGGTCGAGGCAAACGACGCAGTTAGGACCGGCTC
 
. : . : . : . : . : . :
JMFN015B09+ CCTGCAACCGGTACGAGAAGATCCGGTTCAAATTCAACTGCTCGGCGAGGACAATGACTC
JMFN010F17+ CCTGCAACCGGTACGAGAAGATCCGGTTCAAATTCAACTGCTCGGCGAGGACAATGACTC
                      ____________________________________________________________
consensus CCTGCAACCGGTACGAGAAGATCCGGTTCAAATTCAACTGCTCGGCGAGGACAATGACTC
 
. : . : . : . : . : . :
JMFN015B09+ CGGCCAAGCCGGAACCGACCGCGTCGTAGAGCGTGTCGTCGATGCGGTCGGGGTCGAACC
JMFN010F17+ CGGCCAAGCCGGAACCGACCGCGTCGTAGAGCGTGTCGTCGATGCGGTCGGGGTCGAACC
                      ____________________________________________________________
consensus CGGCCAAGCCGGAACCGACCGCGTCGTAGAGCGTGTCGTCGATGCGGTCGGGGTCGAACC
 
. : . : . : . : . : . :
JMFN015B09+ GCGACGCGAGGCCGACGAGGCGGAGGAGAGCGAAGACGAGGGAGCGGAGGTAGGCGACGG
JMFN010F17+ GCGACGCGAGGCCGACGAGGCGGAGGAGAGCGAAGACGAGGGAGCGGAGGTAGGCGACGG
                      ____________________________________________________________
consensus GCGACGCGAGGCCGACGAGGCGGAGGAGAGCGAAGACGAGGGAGCGGAGGTAGGCGACGG
 
. : . : . : . : . : . :
JMFN015B09+ CGTTGGCGAGGAAGACCACCATGAGAATCGGAATCGACTCGGTGGAAACGTCGGTGAGTT
JMFN010F17+ CGTTGGCGAGGAAGACCACCATGAGAATCGGAATCGACTCGGTGGAAACGTCGGTGAGTT
                      ____________________________________________________________
consensus CGTTGGCGAGGAAGACCACCATGAGAATCGGAATCGACTCGGTGGAAACGTCGGTGAGTT
 
. : . : . : . : . : . :
JMFN015B09+ GGTTCTGTAAACCCATCTTCTTCTTCTTCTTCT
JMFN010F17+ GGTTCTGTAAACCCATCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCC
                      ____________________________________________________________
consensus GGTTCTGTAAACCCATCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCC
 
. : . : . : . : . : . :
JMFN010F17+ TGTGATTTGGGGATTTTTGATTTTGAACGAAAATGGTTTTTATTGGAGGAGATGAGAGAA
                      ____________________________________________________________
consensus TGTGATTTGGGGATTTTTGATTTTGAACGAAAATGGTTTTTATTGGAGGAGATGAGAGAA