Previous Contig 002362:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN010E20Sequence613002362 (2)
JMFN044L18Sequence539002362 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN044L18+ AGG
JMFN010E20+ ATTACTCCTCAGG
                      ____________________________________________________________
consensus ATTACTCCTCAGG
 
. : . : . : . : . : . :
JMFN044L18+ CAGGCTTCATCTTCTATCTGTTTCCCAGTCCGCACATTATCGTTCAAGTTTCTTGAAGAT
JMFN010E20+ CAGGCTTCATCTTCTATCTGTTTCCCAGTCCGCACATTCTCGTTCAAGTTTCTTGAAGAT
                      ____________________________________________________________
consensus CAGGCTTCATCTTCTATCTGTTTCCCAGTCCGCACATTCTCGTTCAAGTTTCTTGAAGAT
 
. : . : . : . : . : . :
JMFN044L18+ CAAAGAAGCCCATCAATGGAAGTTTGTAGATCTGTGATTCCGACGCTTTATTCTGTTCAT
JMFN010E20+ CAAAGAAGCCCATCAATGGAAGTTTGTAGATCTGTGATTCCGACGCTTTATTCTGTTCAT
                      ____________________________________________________________
consensus CAAAGAAGCCCATCAATGGAAGTTTGTAGATCTGTGATTCCGACGCTTTATTCTGTTCAT
 
. : . : . : . : . : . :
JMFN044L18+ ATTTTTATTAATTTCTTCGGAAGAAAAACAAGAAAAAAGGGAGAAGGGTGATGAAGTAAG
JMFN010E20+ ATTTTTATTAATTTCTTCAGAAGAAAAACAAGAAAAAAGGGAGAAGGGTGATGAAGTAAG
                      ____________________________________________________________
consensus ATTTTTATTAATTTCTTCGGAAGAAAAACAAGAAAAAAGGGAGAAGGGTGATGAAGTAAG
 
. : . : . : . : . : . :
JMFN044L18+ GTACAGAGGTTTTGGGGGAGATGGATGGAGAAGAAGGTGGTGGGTTGTAGAAGTAGAATG
JMFN010E20+ GTACAGAGGTTTTGGGGGAGATGGATGGAGAAGAAGGTGGTGGGTTGTAGAAGTAGAATG
                      ____________________________________________________________
consensus GTACAGAGGTTTTGGGGGAGATGGATGGAGAAGAAGGTGGTGGGTTGTAGAAGTAGAATG
 
. : . : . : . : . : . :
JMFN044L18+ GGAAGTAGGGGTCGATTGGGTTAGGGGGCGGAGGGGTTGGGCCGGAGGGGTAGTTCTTGT
JMFN010E20+ GGAAGTAGGGGACGATTGGGTTAGGGGGCGGAGGGGTTGGGCCGGAGGGGTAGTTCTTGT
                      ____________________________________________________________
consensus GGAAGTAGGGGTCGATTGGGTTAGGGGGCGGAGGGGTTGGGCCGGAGGGGTAGTTCTTGT
 
. : . : . : . : . : . :
JMFN044L18+ AGGGTGGGGGGAAGTAGTACCCCACCCCTCCGCCGCTGGGGGGAGTGTAGGGTGGGTAGT
JMFN010E20+ AGGGTGGGGGGAAGTAGTACCCCACCCCTCCGCCGCTGGGGGGAGTGTAGGGTGGGTAGT
                      ____________________________________________________________
consensus AGGGTGGGGGGAAGTAGTACCCCACCCCTCCGCCGCTGGGGGGAGTGTAGGGTGGGTAGT
 
. : . : . : . : . : . :
JMFN044L18+ TGGAGGTTGGCGGCGGCGGTGGGGAGTAGTAATTGGTGCCGCCGCCGCTTGAGGTGGGAG
JMFN010E20+ TGGAGGTTGGCGGCGGCGGTGGGGAGTAGTAATTGGTGCCGCCGCCGCTTGAGGTGGGAG
                      ____________________________________________________________
consensus TGGAGGTTGGCGGCGGCGGTGGGGAGTAGTAATTGGTGCCGCCGCCGCTTGAGGTGGGAG
 
. : . : . : . : . : . :
JMFN044L18+ GAGAGGGTGGTGGAGGGCAGTTGAGGGTGGAGGGCGGCGGCGGAGAGGGAGGAGGTGGGG
JMFN010E20+ GAGAGGGTGGTGGAGGGCAGTTGAGGGTGGAGGGCGGCGGCGGAGAGGGAGGAGGTGGGG
                      ____________________________________________________________
consensus GAGAGGGTGGTGGAGGGCAGTTGAGGGTGGAGGGCGGCGGCGGAGAGGGAGGAGGTGGGG
 
. : . : . : . : . : . :
JMFN044L18+ AAGGGGTGGTGCAAGGATTGTCACAGGCGGAGCACATTGTGCACTCGATTTGGTAC
JMFN010E20+ AAGGGGTGGTGCAAGGATTGTCACAGGCGGAGCACATTGTGCACTCGATTTGGTACTTGG
                      ____________________________________________________________
consensus AAGGGGTGGTGCAAGGATTGTCACAGGCGGAGCACATTGTGCACTCGATTTGGTACTTGG
 
. : . : . : . : . : . :
JMFN010E20+ ATCCAGCCCATTCGCCACTCGCCGTAGATATCACCAAACTTGCCAACAAACAAATCTTGA
                      ____________________________________________________________
consensus ATCCAGCCCATTCGCCACTCGCCGTAGATATCACCAAACTTGCCAACAAACAAATCTTGA