Previous Contig 002360:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002J24Sequence505002360 (28)gb:AF261139_17815392e-49Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMFF034D20Sequence557002360 (28)gb:AF261139_17815395e-54Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.764002360 (28)gb:AF261139_17815399e-54Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMFF034F18Sequence357002360 (28)gb:AF261139_17815395e-29Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.608002360 (28)gb:AF261139_17815392e-34Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMFF036G10Sequence443002360 (28)gb:AF261139_17815398e-44Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.772002360 (28)gb:AF261139_17815399e-54Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMFF040C01Sequence489002360 (28)gb:AF261139_17815393e-47Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.621002360 (28)gb:AF261139_17815396e-38Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMFF049E04Sequence623002360 (28)gb:AF261139_17815396e-54Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.624002360 (28)gb:AF261139_17815398e-27Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMFN009P06Sequence599002360 (28)gb:AF261139_17815391e-40Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMFN018I03Sequence616002360 (28)gb:AF261139_17815396e-54Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMFN020K05Sequence488002360 (28)gb:AF261139_17815393e-46Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMFN020K13Sequence562002360 (28)gb:AF261139_17815394e-49Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMFN028A22Sequence474002360 (28)gb:AF261139_17815391e-06Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMFN037E01Sequence518002360 (28)gb:AF261139_17815395e-11Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMFS070E12Sequence476002360 (28)gb:AF261139_17815395e-25Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMSF001M10Sequence288002360 (28)gb:AF261139_17815395e-29Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.739002360 (28)gb:AF261139_17815391e-50Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMSF028P03Sequence665002360 (28)gb:AF261139_17815397e-54Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.732002360 (28)gb:AF261139_17815398e-54Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMSF031E24Sequence660002360 (28)gb:AF261139_17815397e-54Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.637002360 (28)gb:AF261139_17815391e-38Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMSF041K18Sequence834002360 (28)gb:AF261139_17815391e-53Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.791002360 (28)gb:AF261139_17815391e-53Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.
JMSF042E17Sequence769002360 (28)gb:AF261139_17815399e-54Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.747002360 (28)gb:AF261139_17815399e-54Lycopersicon esculentum dehydration-induced protein ERD15 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN028A22- GACCAAAGAATGGTGATAAAA
                      ____________________________________________________________
consensus GACCAAAGAATGGTGATAAAA
 
. : . : . : . : . : . :
JMFN028A22- TTGCAATGCAATTCATGTCTACCAAACAACCCATTAATGTCTAACTTTTAAAATTTTTAC
JMFN037E01+ CATGTCTACCAAACAACCCATTAATGTCTAACTTTTAAAATTTTTAC
rJMSF041K18- ACCCATTAATGTCTAACTTTTAAAATTTTTAC
rJMFF036G10- TAACTTTTAAAATTTTTAC
JMSF042E17+ TAAAATTTTTAC
rJMFF034D20- ATGTCTAACTTTTAAAATTTTTAC
rJMSF042E17- AAATTTTTAC
rJMSF031E24- ACCCATTAATGTCTAACTTTTAAAATTTTTAC
rJMFF040C01- ATGTCTAACTTTT-AAATTTTTAC
rJMFF049E04- CATGTCTACCAAACAACCCATTAATGTCTAACTTTTAAAATTTTTAC
rJMFF034F18- AAATTTTTAC
JMSF041K18+ CATGTCTACCAAACAACCCATTAATGTCTAACTTTTAAAATTTTTAC
                      ____________________________________________________________
consensus TTGCAATGCAATTCATGTCTACCAAACAACCCATTAATGTCTAACTTTTAAAATTTTTAC
 
. : . : . : . : . : . :
JMFN028A22- ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
JMFN037E01+ ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
rJMSF041K18- ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
rJMFF036G10- ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
JMSF042E17+ ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
JMFS070E12+ AAGCTGAACAAAAGTT
rJMFF034D20- ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
rJMSF042E17- ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
rJMSF028P03- ACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
rJMSF001M10- TTTTTGTCANAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
rJMSF031E24- ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
rJMFF040C01- ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
rJMFF049E04- ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
rJMFF034F18- ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
JMSF041K18+ ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
                      ____________________________________________________________
consensus ATTTTTGTCAAAAGATTTCTACTTTTCAACAGAGTTTTTGGTTTAAGCTGAACAAAAGTT
 
. : . : . : . : . : . :
JMFN028A22- TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
JMFN037E01+ TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
rJMSF041K18- TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
rJMFF036G10- TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
JMSF042E17+ TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
JMFN018I03+ A
JMFS070E12+ TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
rJMFF034D20- TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
rJMSF042E17- TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
rJMSF028P03- TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
rJMSF001M10- TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
rJMSF031E24- TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
rJMFF040C01- TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
rJMFF049E04- TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
rJMFF034F18- TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
JMSF041K18+ TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
JMSF031E24+ CCATGCCCTATACAAAAGATACA
JMSF028P03+ ACCTACCATGCCCTATACAAAAGATACA
                      ____________________________________________________________
consensus TGGAATGAACAAGGCTAGATACAAGGGCGGAAACCTACCATGCCCTATACAAAAGATACA
 
. : . : . : . : . : . :
JMFN028A22- ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
JMFN037E01+ ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
rJMSF041K18- ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
rJMFF036G10- ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
JMSF042E17+ ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
JMFN018I03+ ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
JMFS070E12+ ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
rJMFF034D20- ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
rJMSF042E17- ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
rJMSF028P03- ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
rJMSF001M10- ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTANAGCTGGCTAT
rJMSF031E24- ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
rJMFF040C01- ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
rJMFF049E04- ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
rJMFF034F18- ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
JMSF041K18+ ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
JMSF031E24+ ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCNGGCTAT
JMFN020K13+ TGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
JMFF049E04+ CAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
JMSF028P03+ ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
                      ____________________________________________________________
consensus ACAGATTTAAAGACAAAATGACTGGCTGCAGTGACATAACTGCCAAGTAGAGCTGGCTAT
 
. : . : . : . : . : . :
JMFN028A22- GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTAGATGATGCGAGTGTTCCATT
JMFN037E01+ GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
rJMSF041K18- GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
rJMFF036G10- GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
JMSF042E17+ GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
JMFN018I03+ GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
JMFS070E12+ GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
rJMFF034D20- GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
rJMSF042E17- GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
rJMSF028P03- GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
rJMSF001M10- GCTAAAACCTGGCTAGCTAAAACATTCANCGGGGCTGCTGGATGATGCGAGTGTTCCATT
rJMSF031E24- GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
rJMFF040C01- GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
rJMFF049E04- GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
rJMFF034F18- GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
JMSF041K18+ GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
JMSF031E24+ GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
JMFN020K13+ GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
JMFF049E04+ GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
JMFF034D20+ AAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
JMSF028P03+ GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
                      ____________________________________________________________
consensus GCTAAAACCTGGCTAGCTAAAACATTCAGCGGGGCTGCTGGATGATGCGAGTGTTCCATT
 
. : . : . : . : . : . :
JMFN028A22- TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMFN037E01+ TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
rJMSF041K18- TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
rJMFF036G10- TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMSF042E17+ TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMFN018I03+ TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMFS070E12+ TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
rJMFF034D20- TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
rJMSF042E17- TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
rJMSF028P03- TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
rJMSF001M10- TCGGGCTAACAGTCTTTGCCGGCCTCTCATANTACTTGGGTGGCTCAATGGGGGATTTAG
rJMSF031E24- TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
rJMFF040C01- TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
rJMFF049E04- TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
rJMFF034F18- TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMSF041K18+ TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMSF031E24+ TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMFN020K13+ TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMFF049E04+ TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMFN020K05+ CGGGGTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMFF034D20+ TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMFF040C01+ CATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMFF002J24+ GTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
JMSF028P03+ TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
                      ____________________________________________________________
consensus TCGGGCTAACAGTCTTTGCCGGCCTCTCATAGTACTTGGGTGGCTCAATGGGGGATTTAG
 
. : . : . : . : . : . :
JMFN028A22- GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMFN037E01+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
rJMSF041K18- GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
rJMFF036G10- GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMSF042E17+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMFN018I03+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMFS070E12+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
rJMFF034D20- GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
rJMSF042E17- GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
rJMSF028P03- GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
rJMSF001M10- GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCANCGAATCACTATGTTTGTTAANAC
rJMSF031E24- GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
rJMFF040C01- GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
rJMFF049E04- GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
rJMFF034F18- GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMSF041K18+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMSF031E24+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMFN020K13+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMFF049E04+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMFN020K05+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMFF034D20+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMFF040C01+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMFF036G10+ GGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMFF002J24+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMSF028P03+ GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
JMFN009P06+ TTAAAAC
                      ____________________________________________________________
consensus GCCCCCTCTCCTTGGGGAAGCTCAGACTTCTTAGCAACGAATCACTATGTTTGTTAAAAC
 
. : . : . : . : . : . :
JMFN028A22- CGGATTCAGGAAAACCCTTTACACCCGCGAGAG
JMFN037E01+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
rJMSF041K18- CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
rJMFF036G10- CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMSF042E17+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMFN018I03+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMFS070E12+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
rJMFF034D20- CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
rJMSF042E17- CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
rJMSF028P03- CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
rJMSF001M10- CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAN
rJMSF031E24- CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
rJMFF040C01- CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
rJMFF049E04- CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
rJMFF034F18- CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAN
JMSF041K18+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMSF031E24+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMFN020K13+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMFF049E04+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMFN020K05+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMFF034D20+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMFF040C01+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMFF036G10+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMFF034F18+ CACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMFF002J24+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMSF028P03+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
JMFN009P06+ CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
                      ____________________________________________________________
consensus CGGATTCAGGAAAACCCTTTACACCCGCGAGAGAAGACTGATATGTTTGCTCACTTGCAG
 
. : . : . : . : . : . :
JMFN037E01+ TTGATTGGAGAAACTCT
rJMSF041K18- TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
rJMFF036G10- TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMSF042E17+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMFN018I03+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMFS070E12+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
rJMFF034D20- TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
rJMSF042E17- TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
rJMSF028P03- TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
rJMSF001M10- TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
rJMSF031E24- TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
rJMFF040C01- TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
rJMFF049E04- TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
rJMFF034F18- TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMSF041K18+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMSF031E24+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMFN020K13+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMFF049E04+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMFN020K05+ TTGATTGGAGAAACTCTTCATAATGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMFF034D20+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMFF040C01+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMFF036G10+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMFF034F18+ TTGATTGGAGAAACTCTTCATANTGAGCTTCCATGTTCAATATGTCNTCATCAACATCGA
JMSF001M10+ ATCAACATCGA
JMFF002J24+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMSF028P03+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
JMFN009P06+ TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
                      ____________________________________________________________
consensus TTGATTGGAGAAACTCTTCATACTGAGCTTCCATGTTCAATATGTCCTCATCAACATCGA
 
. : . : . : . : . : . :
rJMSF041K18- GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
rJMFF036G10- GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMSF042E17+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMFN018I03+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMFS070E12+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTT
rJMFF034D20- GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
rJMSF042E17- GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
rJMSF028P03- GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
rJMSF001M10- GATCAATGGTATCAGGCANCAAATCAGCTACNTCATTGTTATCATATTCTGTTCCCTGCT
rJMSF031E24- GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
rJMFF040C01- GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
rJMFF049E04- GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
rJMFF034F18- GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMSF041K18+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMSF031E24+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMFN020K13+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMFF049E04+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMFN020K05+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMFF034D20+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMFF040C01+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMFF036G10+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMFF034F18+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMSF001M10+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMFF002J24+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMSF028P03+ GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
JMFN009P06+ GATCAATGGTATCAGGCAACAAATCAGTTACATCATTGTTATCATATTCTGTTCCCTGCT
                      ____________________________________________________________
consensus GATCAATGGTATCAGGCAACAAATCAGCTACATCATTGTTATCATATTCTGTTCCCTGCT
 
. : . : . : . : . : . :
rJMSF041K18- GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
rJMFF036G10- GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMSF042E17+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMFN018I03+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
rJMFF034D20- GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
rJMSF042E17- GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
rJMSF028P03- GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
rJMSF001M10- GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGANTTCATCAGGTTCCACCATTCAG
rJMSF031E24- GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
rJMFF040C01- GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTC
rJMFF049E04- GCTGGCTGA
rJMFF034F18- GCTGGCTGAGCCAATAGTCATGGAANCATGTGGCAGAATTCATCAGGTTCCA
JMSF041K18+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMSF031E24+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMFN020K13+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMFF049E04+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMFN020K05+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMFF034D20+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMFF040C01+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMFF036G10+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMFF034F18+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMSF001M10+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMFF002J24+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMSF028P03+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
JMFN009P06+ GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
                      ____________________________________________________________
consensus GCTGGCTGAGCCAATAGTCATGGAACCATGTGGCAGAATTCATCAGGTTCCACCATTCAG
 
. : . : . : . : . : . :
rJMSF041K18- GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
rJMFF036G10- GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMSF042E17+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMFN018I03+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
rJMFF034D20- GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
rJMSF042E17- GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
rJMSF028P03- GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
rJMSF001M10- GTGAGAAGTCCTCCAATGCACGTACGGAA-NCAGGAACAAACAATGGTGCATTTGGATTC
rJMSF031E24- G
JMSF041K18+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMSF031E24+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMFN020K13+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMFF049E04+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMFN020K05+ GTGAGAAGTCCTCCAATGCACGTACGGAACGCAGGAACAAACAATGGTGCATTTGGATTC
JMFF034D20+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMFF040C01+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMFF036G10+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMFF034F18+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMSF001M10+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMFF002J24+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMSF028P03+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
JMFN009P06+ GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
                      ____________________________________________________________
consensus GTGAGAAGTCCTCCAATGCACGTACGGAA-GCAGGAACAAACAATGGTGCATTTGGATTC
 
. : . : . : . : . : . :
rJMSF041K18- AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTC-TTAAACAACTAT-CTTT
rJMFF036G10- AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMSF042E17+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMFN018I03+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
rJMFF034D20- AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
rJMSF042E17- AGTGTTGACCTTCCTCCAGAAACTAATGCCATTCCTTCCTTCTTTAAACAACTATCCTTT
rJMSF028P03- AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
rJMSF001M10- AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAANCAACTAT-CTNG
JMSF041K18+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMSF031E24+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMFN020K13+ AGTGTT-ACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCT
JMFF049E04+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMFN020K05+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMFF034D20+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMFF040C01+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMFF036G10+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMFF034F18+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMSF001M10+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMFF002J24+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMSF028P03+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
JMFN009P06+ AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CCAA
                      ____________________________________________________________
consensus AGTGTTGACCTTCCTCCAGAAACTAATGCCATT-CTTCCTTCTTTAAACAACTAT-CTTT
 
. : . : . : . : . : . :
rJMSF041K18- GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAGCTTC
rJMFF036G10- GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAG
JMSF042E17+ GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAGCTTC
JMFN018I03+ GATTGCAAATATCTGCGC
rJMFF034D20- GATTGCAAATATCTGCGCGTAGC
rJMSF042E17- GATTGCAAATATCTGCGC
rJMSF028P03- GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAG
rJMSF001M10- GATTGCAANTATCTGCGCGTA
JMSF041K18+ GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAGCTTC
JMSF031E24+ GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAGCTTC
JMFF049E04+ GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAGCTT
JMFN020K05+ GATTGCAAATA
JMFF034D20+ GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAGCTT
JMFF040C01+ GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAGCTT
JMFF036G10+ GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAGC
JMFF034F18+ GATTGCAAATATNTGCGCGTA
JMSF001M10+ GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAGC
JMFF002J24+ GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAGCTT
JMSF028P03+ GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAGCTTC
JMFN009P06+ ACTATCATGGATGAATGGATA---ATCTAAA--AACTTTCCAACATAAAGAATCCAACAT
                      ____________________________________________________________
consensus GATTGCAAATATCTGCGCGTAGCCTGCTAAACGAAGCTTCCAACATAAAGAATCCAACAT
 
. : . : . : . : . : . :
JMFN009P06+ CATCCATACAAATTATAATCTTAAAATACTGTATCAAGGCGTGCTTAAATTTATATACGG
                      ____________________________________________________________
consensus CATCCATACAAATTATAATCTTAAAATACTGTATCAAGGCGTGCTTAAATTTATATACGG
 
. : . : . : . : . : . :
JMFN009P06+ AGCATATTACATATAGCAATATAGCATAGTACTCCGTACATATACACACACAGATACACG
                      ____________________________________________________________
consensus AGCATATTACATATAGCAATATAGCATAGTACTCCGTACATATACACACACAGATACACG
 
. : . : . : . : . : . :
JMFN009P06+ TATATGGATGACCTTCCTTCGACTCCGATTACTTTGATTGCAAATATCTGCGCGTAGCCT
                      ____________________________________________________________
consensus TATATGGATGACCTTCCTTCGACTCCGATTACTTTGATTGCAAATATCTGCGCGTAGCCT