Previous Contig 002354:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN008B03Sequence641002354 (4)gb:SSAJ4824_25802310.012Salmo salar mRNA for U2 snRNP-specific A' protein (transcript 1).
JMFN009M01Sequence600002354 (4)
JMFN037F14Sequence459002354 (4)gb:SSAJ4824_25802310.032Salmo salar mRNA for U2 snRNP-specific A' protein (transcript 1).
JMFN038L21Sequence531002354 (4)pir|T04441|T044410.010hypothetical protein T18B16.170 - Arabidopsis thaliana>gb:ATT18B16_1554752 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN038L21+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
JMFN038L21+ AGCAGATCAGATGTGCATTAATATAATGTGAGCTGAGAAATTACATGTACATAGACTCAT
                      ____________________________________________________________
consensus AGCAGATCAGATGTGCATTAATATAATGTGAGCTGAGAAATTACATGTACATAGACTCAT
 
. : . : . : . : . : . :
JMFN038L21+ AATGAATATATATGTTGCATAAATACATGTATGCCTTTGTCATGCATGCATGCATGGTTA
                      ____________________________________________________________
consensus AATGAATATATATGTTGCATAAATACATGTATGCCTTTGTCATGCATGCATGCATGGTTA
 
. : . : . : . : . : . :
JMFN038L21+ TCATCACTACTTCCAACGCTTGAAGCTGCGCTTTCCATACTTCCCTTGCTTGATCTTTCC
                      ____________________________________________________________
consensus TCATCACTACTTCCAACGCTTGAAGCTGCGCTTTCCATACTTCCCTTGCTTGATCTTTCC
 
. : . : . : . : . : . :
JMFN038L21+ ATGCTTGAATTTTCCATGGTGCCCATAGTAACCACCATGCATATGATGATGACCATGTGC
                      ____________________________________________________________
consensus ATGCTTGAATTTTCCATGGTGCCCATAGTAACCACCATGCATATGATGATGACCATGTGC
 
. : . : . : . : . : . :
JMFN038L21+ AAGATGGTGAGCTCCAATTGCAGCAGCTGCAGCTGCAGCACCTCCAGCTAACATTGTTCC
JMFN008B03+ TGAGCTCCAATTGCAGCAGCTGCAGCTGCAGCACCTCCAGCTAACATTGTTCC
                      ____________________________________________________________
consensus AAGATGGTGAGCTCCAATTGCAGCAGCTGCAGCTGCAGCACCTCCAGCTAACATTGTTCC
 
. : . : . : . : . : . :
JMFN038L21+ AAAGTTATTAGATCCTTGCCCCGCACCATGATGTGAAGTTGATGGGGGTGGATAGCCAGC
JMFN008B03+ AAAGTTATTAGATCCTTGCCCCGCACCATGATGTGAAGTTGATGGGGGTGGATAGCCAGC
JMFN009M01+ AAAGTTATTAGATCCTTGCNCCGCACCATGATGTGAAGTTGATGAGGGTGGATAGCCAGC
                      ____________________________________________________________
consensus AAAGTTATTAGATCCTTGCCCCGCACCATGATGTGAAGTTGATGGGGGTGGATAGCCAGC
 
. : . : . : . : . : . :
JMFN038L21+ AGGAGGATAGCCATGTTGGGGAAATGCACCACTCGGCGGAGGATATACCGCCGGCGCCGG
JMFN008B03+ AGGAGGATAGCCATGTTGGGGAAATGCACCACTCGGCGGAGGATATACCGCCGGCGCCGG
JMFN009M01+ AGGAGGATAGCCATGTTGGGGAAATGCACCACTCGGCGGAGGATATACCGCCGGCGCCGG
                      ____________________________________________________________
consensus AGGAGGATAGCCATGTTGGGGAAATGCACCACTCGGCGGAGGATATACCGCCGGCGCCGG
 
. : . : . : . : . : . :
JMFN038L21+ CGCCGGGTAGCCAGCCGGAGGGGGAGGGTGTGCACCGGCAGGAGGATACCCTTCCGGGCT
JMFN008B03+ CGCCGGGTAGCCAGCCGGAGGGGGAGGGTGTGCACCGGCAGGAGGATACCCTTCCGGGCT
JMFN037F14+ GGAGGGGGAGGGTGTGCACCGGCAGGAGGATACCCTTCCGGGCT
JMFN009M01+ CGCCGGGTAGCCAGCCGGAGGGGGAGGGTGTGCACCGGCAGTAGGATACCCTTCCGGGCT
                      ____________________________________________________________
consensus CGCCGGGTAGCCAGCCGGAGGGGGAGGGTGTGCACCGGCAGGAGGATACCCTTCCGGGCT
 
. : . : . : . : . : . :
JMFN038L21+ GTATCCAGGTGAAGGAGGGGGAGGGTGTGCACCGGCAAGAGGAGGATACC
JMFN008B03+ GTATCCAGGTGAAGGAGGGGGAGGGTGTGCACCAGCAAGAGGAGGATACCCTTCCGGCGG
JMFN037F14+ GTATCCAGGTGAAGGAGGGGGAGGGTGTGCACCGGCAAGAGGAGGATACCCTTCCGGCGG
JMFN009M01+ GTATCCAGGTGAAGGAGGGGGAGGGTGTGCACCGGCAAGAGCAGGATACCCTTCCGGCGG
                      ____________________________________________________________
consensus GTATCCAGGTGAAGGAGGGGGAGGGTGTGCACCGGCAAGAGGAGGATACCCTTCCGGCGG
 
. : . : . : . : . : . :
JMFN008B03+ CATGTATCCAGGTGAAGGAGGAGGAGGATGGGGATATCCGGCAGGTGATGGGTATGCCCC
JMFN037F14+ CAGGTATCCAGGTGAAGGAGGAGGAGGATGGGGATATCCGGCAGGTGATGGGTATGCCCC
JMFN009M01+ CATGTATCCAGGTGAAGGAGGAGGAGGATGGGGATATCCGGCAGGTGATGGGTATGCCCC
                      ____________________________________________________________
consensus CATGTATCCAGGTGAAGGAGGAGGAGGATGGGGATATCCGGCAGGTGATGGGTATGCCCC
 
. : . : . : . : . : . :
JMFN008B03+ TGCAGCAGGAGGAGGAGGATGAGGATATCCGGCAGCTGGTGGGTATGCCCCAGCAGGAGG
JMFN037F14+ TGCAGCAGGAGGAGGAGGATGAGGATATCCGGCAGCTGGTGGGTATGCCCCAGCAGGAGG
JMFN009M01+ TGCAGCAGGAGGAGGAGGATGAGGATATCCGGCAGCTGGTGGGTATGCCCCAGCAGGAGG
                      ____________________________________________________________
consensus TGCAGCAGGAGGAGGAGGATGAGGATATCCGGCAGCTGGTGGGTATGCCCCAGCAGGAGG
 
. : . : . : . : . : . :
JMFN008B03+ AGAAGGATGAGGATATCCATGATGACCGCCGCCGTAGCCTCCCGGACGGTGATGACCGGC
JMFN037F14+ AAAAGGATGAGGATATCCATGATGGCCGCCGCCGTAGCCTCCCGGACGGTGATGACCGGC
JMFN009M01+ AGAAGGATGAGGATATCCATGATGACCGCCGCCGTAGCCTCCCGGACGGTGATGACCGGC
                      ____________________________________________________________
consensus AGAAGGATGAGGATATCCATGATGACCGCCGCCGTAGCCTCCCGGACGGTGATGACCGGC
 
. : . : . : . : . : . :
JMFN008B03+ GCCGGCAAATCCGGCAAGGTTAGAAAGCAGCCCCCTTCCCTGGAACTCTGGCTTTCCCTT
JMFN037F14+ GCCGGCAAATCCGGCAAGGTTAGAAAGCAGCCCCCTTCCCTGGAACTCTGGCTTTCCCTT
JMFN009M01+ GCCGGCAAATCCGGCAAGGTTAGAAAGCAGCCCCCTTCCCTGGAACTCTGGCTTTCCCTT
                      ____________________________________________________________
consensus GCCGGCAAATCCGGCAAGGTTAGAAAGCAGCCCCCTTCCCTGGAACTCTGGCTTTCCCTT
 
. : . : . : . : . : . :
JMFN008B03+ CCCCATTTTTATTCAGCTCCGGCGATAGATTACACACCTATAACTAGATAGATTCCTAGT
JMFN037F14+ CCCCATTTTTATTCAGCTCCGGCGATAGATTACACACCTATAACTAGATAGATTCCTAGT
JMFN009M01+ CCCCATTTTTATTCAGCTCCGGCGATAGATTACACACCTATAACTAGATAGATTCCTAGT
                      ____________________________________________________________
consensus CCCCATTTTTATTCAGCTCCGGCGATAGATTACACACCTATAACTAGATAGATTCCTAGT
 
. : . : . : . : . : . :
JMFN008B03+ TTAAGGAAAGGATAAAATCCTTCCTTGGTAGTGTAATCTAGAACCGAA
JMFN037F14+ TTAAGGAAAGGATAAAATCCTTCCTTGGTAGTGTAATCTAGAACCGAA
JMFN009M01+ TTAAGGAAAGGATAAAATCCTTCCTTGGTAGTGTAATCTAGAACCGAAGATTATGAAGGG
                      ____________________________________________________________
consensus TTAAGGAAAGGATAAAATCCTTCCTTGGTAGTGTAATCTAGAACCGAAGATTATGAAGGG