Previous Contig 002344:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012C02Sequence609002344 (12)gb:AY331382_1599910e-100Brassica juncea ARD-like protein (ARD1) mRNA, complete cds.806002344 (12)gb:AY331382_1599910e-100Brassica juncea ARD-like protein (ARD1) mRNA, complete cds.
JMFF018B19Sequence478002344 (12)gb:AY331382_15999105e-74Brassica juncea ARD-like protein (ARD1) mRNA, complete cds.303021062gb:AX277508_14651018e-04Sequence 5 from Patent WO0161020.
JMFF024O21Sequence523002344 (12)gb:AY331382_15999101e-77Brassica juncea ARD-like protein (ARD1) mRNA, complete cds.776002344 (12)gb:AY086754_1571797e-100Arabidopsis thaliana clone 2738 mRNA, complete sequence.>gb:BT020561_1642955 Ara
JMFF034C09Sequence533002344 (12)gb:AY331382_15999109e-79Brassica juncea ARD-like protein (ARD1) mRNA, complete cds.694002344 (12)gb:AY086754_15717974e-85Arabidopsis thaliana clone 2738 mRNA, complete sequence.>gb:BT020561_1642955 Ara
JMFF040K01Sequence691002344 (12)gb:AY086754_15717974e-85Arabidopsis thaliana clone 2738 mRNA, complete sequence.>gb:BT020561_1642955 Ara
JMFN003F08Sequence634002344 (12)gb:AY331382_1599910e-102Brassica juncea ARD-like protein (ARD1) mRNA, complete cds.
JMFN009E01Sequence614002344 (12)gb:AY086754_15717975e-58Arabidopsis thaliana clone 2738 mRNA, complete sequence.>gb:BT020561_1642955 Ara
JMSF001P08Sequence224002344 (12)gb:AY086754_15717976e-17Arabidopsis thaliana clone 2738 mRNA, complete sequence.>gb:BT020561_1642955 Ara769002344 (12)gb:AY086754_1571797e-101Arabidopsis thaliana clone 2738 mRNA, complete sequence.>gb:BT020561_1642955 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF018B19- AG
JMFF024O21- AGGGGGGCTCTATCCGAAACATACAG
JMSF001P08- AGGGGGGCTCTATCCGAAACATACAG
JMFF034C09- ATTTGAGGGGGGCTCTATCCGAAACATACAG
                      ____________________________________________________________
consensus ATTTGAGGGGGGCTCTATCCGAAACATACAG
 
. : . : . : . : . : . :
JMFF018B19- AAACACTTTTCATACATCTTTTTGCGGGGAGAATTCTAAGCCGTGAAAAAATGGGCTCAA
JMFF024O21- AAACACTTTTCATACATCTTTTTGCGGGGAGAATTCTAAGCCGTGAAAAAATGGGCTCAA
JMSF001P08- AAACACTTTTCATACATCTTTTTGCGGGGAGAATTCTAAGCCGTGAAAAAATGGGCTCAA
JMFF034C09- AAACACTTTTCATACATCTTTTTGCGGGGAGAATTCTAAGCCGTGAAAAAATGGGCTCAA
JMFF012C02- ACTTTTCATACATCTTTTTGCGGGGAGAATTCTAAGCCGTGAAAAAATGGGCTCAA
JMFN003F08- TTTTGCGGGGAGAATTCTAAGCCGTGAAAAAATGGGCTCAA
rJMFF012C02+ CCGTGAAAAAATGGGCTCAA
rJMSF001P08+ AAAAATNGGCTCCA
                      ____________________________________________________________
consensus AAACACTTTTCATACATCTTTTTGCGGGGAGAATTCTAAGCCGTGAAAAAATGGGCTCAA
 
. : . : . : . : . : . :
JMFF018B19- TTGAGAAGGATAGCAGGGAGGAAATTATTCAGGCATGGTATATGGATGATAGCAATGAAG
JMFF024O21- TTGAGAAGGATAGCAGGGAGGAAATTATTCAGGCATGGTATATGGATGATAGCAATGAAG
JMSF001P08- TTGAGAAGGATAGCAGGGAGGAAATTATTCAGGCATGGTATATGGATGATAGCAATGAAG
JMFF034C09- TTGAGAAGGATAGCAGGGAGGAAATTATTCAGGCATGGTATATGGATGATAGCAATGAAG
JMFF012C02- TTGAGAAGGATAGCAGGGAGGAAATTATTCAGGCATGGTATATGGATGATAGCAATGAAG
JMFN003F08- TTGAGAAGGATAGCAGGGAGGAAATTATTCAGGCATGGTATATGGATGATAGCAATGAAG
rJMFF012C02+ NTGAGAAGGATAGCAGGGAGGAAATTATTCAGGCATGGTATATGGATGATAGCAATGAAG
rJMSF001P08+ TTGAGAAGGATAGCAGGGAGGAAATTATTCAGGCATGGTATATGGATGATAGCAATGAAG
rJMFF024O21+ AGAAGGATAGCAGGGAGGAAATTATTCAGGCATGGTATATGGATGATAGCAATGAAG
                      ____________________________________________________________
consensus TTGAGAAGGATAGCAGGGAGGAAATTATTCAGGCATGGTATATGGATGATAGCAATGAAG
 
. : . : . : . : . : . :
JMFF018B19- ATCAGAGGCTTCCCCATCACCGTGAGCCAAAGCAGTTTGTCTCCCTTGACAAACTTGCTG
JMFF024O21- ATCAGAGGCTTCCCCATCACCGTGAGCCAAAGCAGTTTGTCTCCCTTGACAAACTTGCTG
JMSF001P08- ATCAGAGGCTTCCCCATCACCGTGAGCCAAAGCAGTTTGTCTCCCTTGACAAACTTGCTG
JMFF034C09- ATCAGAGGCTTCCCCATCACCGTGAGCCAAAGCAGTTTGTCTCCCTTGACAAACTTGCTG
JMFF012C02- ATCAGAGGCTTCCCCATCACCGTGAGCCAAAGCAGTTTGTCTCCCTTGACAAACTTACTG
JMFN003F08- ATCAGAGGCTTCCCCATCACCGTGAGCCAAAGCAGTTTGTCTCCCTTGACAAACTTGCTG
rJMFF012C02+ ATCAGAGGCTTCCCCATCACCGTGAGCCAAAGCAGTTTGTCTCCCTTGACAAACTTACTG
rJMSF001P08+ ATCAGAGGCTTCCCCATCACCGTGAGCCAAAGCAGTTTGTCTCCCTTGACAAACTTGCTG
rJMFF034C09+ TGAGCCAAAGCAGTTTGTCTCCCTTGACAAACTTGCTG
rJMFF040K01+ GAGCCAAAGCAGTTTGTCTCCCTTGACAAACTTGCTG
rJMFF024O21+ ATCAGAGGCTTCCCCATCACCGTGAGCCAAAGCAGTTTGTCTCCCTTGACAAACTTGCTG
                      ____________________________________________________________
consensus ATCAGAGGCTTCCCCATCACCGTGAGCCAAAGCAGTTTGTCTCCCTTGACAAACTTGCTG
 
. : . : . : . : . : . :
JMFF018B19- AGCTTGGAGTGCTCAGCTGGAGGTTGGATGCTGACAAATATGAAACAGATGAGGAGTTGA
JMFF024O21- AGCTTGGAGTGCTCAGCTGGAGGTTGGATGCTGACAAATATGAAACAGATGAGGAGTTGA
JMSF001P08- AGCTTGGAGTGCTCAG
JMFF034C09- AGCTTGGAGTGCTCAGCTGGAGGTTGGATGCTGACAAATATGAAACAGATGAGGAGTTGA
JMFF012C02- AGCTTGGAGTGCTCAGCTGGAGGTTGGATGCTGACAAATATGAAACAGATGAGGAGTTGA
JMFN003F08- AGCTTGGAGTGCTCAGCTGGAGGTTGGATGCTGACAAATATGAAACAGATGAGGAGTTGA
rJMFF012C02+ AGCTTGGAGTGCTCAGCTGGAGGTTGGATGCTGACAAATATGAAACAGATGAGGAGTTGA
rJMSF001P08+ AGCTTGGAGTGCTCAGCTGGAGGTTGGATGCTGACAAATATGAAACAGATGAGGAGTTGA
rJMFF034C09+ AGCTTGGAGTGCTCAGCTGGAGGTTGGATGCTGACAAATATGAAACAGATGAGGAGTTGA
rJMFF040K01+ AGCTTGGAGTGCTCAGCTGGAGGTTGGATGCTGACAAATATGAAACAGATGAGGAGTTGA
rJMFF024O21+ AGCTTGGAGTGCTCAGCTGGAGGTTGGATGCTGACAAATATGAAACAGATGAGGAGTTGA
                      ____________________________________________________________
consensus AGCTTGGAGTGCTCAGCTGGAGGTTGGATGCTGACAAATATGAAACAGATGAGGAGTTGA
 
. : . : . : . : . : . :
JMFF018B19- AGAAAATCCGTGAATCCCGAGGATATTCATACATGGACTTCTGCGAGGTTTGCCCTGAGA
JMFF024O21- AGAAAATCCGTGAATCCCGAGGATATTCATACATGGACTTCTGCGAGGTTTGCCCTGAGA
JMFF034C09- AGAAAATCCGTGAATCCCGAGGATATTCATACATGGACTTCTGCGAGGTTTGCCCTGAGA
JMFF012C02- AGAAAATCCGTGAATCCCGAGGATATTCATACATGGACTTCTGCGAGGTTTGCCCTGAGA
JMFN003F08- AGAAAATCCGTGAATCCCGAGGATATTCATACATGGACTTCTGCGAGGTTTGCCCTGAGA
rJMFF012C02+ AGAAAATCCGTGAATCCCGAGGATATTCATACATGGACTTCTGCGAGGTTTGCCCTGAGA
rJMSF001P08+ AGAAAATCCGTGAATCCCGAGGATATTCATACATGGACTTCTGCGAGGTTTGCCCTGAGA
rJMFF034C09+ AGAAAATCCGTGAATCCCGAGGATATTCATACATGGACTTCTGCGAGGTTTGCCCTGAGA
rJMFF040K01+ AGAAAATCCGTGAATCCCGAGGATATTCATACATGGACTTCTGCGAGGTTTGCCCTGAGA
rJMFF024O21+ AGAAAATCCGTGAATCCCGAGGATATTCATACATGGACTTCTGCGAGGTTTGCCCTGAGA
JMFN009E01+ GGTTTGCCCTGAGA
                      ____________________________________________________________
consensus AGAAAATCCGTGAATCCCGAGGATATTCATACATGGACTTCTGCGAGGTTTGCCCTGAGA
 
. : . : . : . : . : . :
JMFF018B19- AGTTGCCGAATTATGAAGAGAAGATCAAGAGCTTCTTTGAAGAGCATCTGCACACAGATG
JMFF024O21- AGTTGCCGAATTATGAAGAGAAGATCAAGAGCTTCTTTGAAGAGCATCTGCACACAGATG
JMFF034C09- AGTTGCCGAATTATGAAGAGAAGATCAAGAGCTTCTTTGAAGAGCATCTGCACACAGATG
JMFF012C02- AGTTGCCGAATTATGAAGAGAAGATCAAGAGCTTCTTTGAAGAGCATCTGCACACAGATG
JMFN003F08- AGTTGCCGAATTATGAAGAGAAGATCAAGAGCTTCTTTGAAGAGCATCTGCACACAGATG
rJMFF012C02+ AGTTGCCGAATTATGAAGAGAAGATCAAGAGCTTCTTTGAAGAGCATCTGCACACAGATG
rJMSF001P08+ AGTTGCCGAATTATGAAGAGAAGATCAAGAGCTTCTTTGAAGAGCATCTGCACACAGATG
rJMFF034C09+ AGTTGCCGAATTATGAAGAGAAGATCAAGAGCTTCTTTGAAGAGCATCTGCACACAGATG
rJMFF040K01+ AGTTGCCGAATTATGAAGAGAAGATCAAGAGCTTCTTTGAAGAGCATCTGCACACAGATG
rJMFF024O21+ AGTTGCCGAATTATGAAGAGAAGATCAAGAGCTTCTTTGAAGAGCATCTGCACACAGATG
JMFN009E01+ AGTTGCCGAATTATGAAGAGAAGATCAAGAGCTTCTTTGAAGAGCATCTGCACACAGATG
                      ____________________________________________________________
consensus AGTTGCCGAATTATGAAGAGAAGATCAAGAGCTTCTTTGAAGAGCATCTGCACACAGATG
 
. : . : . : . : . : . :
JMFF018B19- AGGAAATCCGCTACTGTGTTGCTGGGAGTGGCTATTTTGATGTGCGTGACAAGAATGAGG
JMFF024O21- AGGAAATCCGCTACTGTGTTGCTGGGAGTGGCTATTTTGATGTGCGTGACAAGAATGAGG
JMFF034C09- AGGAAATCCGCTACTGTGTTGCTGGGAGTGGCTATTTTGATGTGCGTGACAAGAATGAGG
JMFF012C02- AGGAAATCCGCTACTGTGTTGCTGGGAGTGGCTATTTTGATGTGCGTGACAAGAATGAGG
JMFN003F08- AGGAAATCCGCTACTGTGTTGCTGGGAGTGGCTATTTTGATGTGCGTGACAAGAATGAGG
rJMFF012C02+ AGGAAATCCGCTACTGTGTTGCTGGGAGTGGCTATTTTGATGTGCGTGACAAGAATGAGG
rJMSF001P08+ AGGAAATCCGCTACTGTGTTGCTGGGAGTGGCTATTTTGATGTGCGTGACAAGAATGAGG
rJMFF034C09+ AGGAAATCCGCTACTGTGTTGCTGGGAGTGGCTATTTTGATGTGCGTGACAAGAATGAGG
rJMFF040K01+ AGGAAATCCGCTACTGTGTTGCTGGGAGTGGCTATTTTGATGTGCGTGACAAGAATGAGG
rJMFF024O21+ AGGAAATCCGCTACTGTGTTGCTGGGAGTGGCTATTTTGATGTGCGTGACAAGAATGAGG
JMFN009E01+ AGGAAATCCGCTACTGTGTTGCTGGGAGTGGCTATTTTGATGTGCGTGACAAGAATGAGG
                      ____________________________________________________________
consensus AGGAAATCCGCTACTGTGTTGCTGGGAGTGGCTATTTTGATGTGCGTGACAAGAATGAGG
 
. : . : . : . : . : . :
JMFF018B19- AATGGATCCGCATCTGGGTGAAGAAAGGGGCAATGATTGTTCTGCCTGCTGGAATT
JMFF024O21- AATGGATCCGCATCTGGGTGAAGAAAGGGGCAATGATTGTTCTGCCTGCTGGAATTTATC
JMFF034C09- AATGGATCCGCATCTGGGTGAAGAAAGGGGCAATGATTGTTCTGCCTGCTGGAATTTATC
JMFF012C02- AATGGATCCGCATCTGGGTGAAGAAAGGGGCAATGATTGTTCTGCCTGCTGGAATTTATC
JMFN003F08- AATGGATCCGCATCTGGGTGAAGAAAGGGGCAATGATTGTTCTGCCTGCTGGAATTTATC
rJMFF012C02+ AATGGATCCGCATCTGGGTGAAGAAAGGGGCAATGATTGTTCTGCCTGCTGGAATTTATC
rJMSF001P08+ AATGGATCCGCATCTGGGTGAAGAAAGGGGCAATGATTGTTCTGCCTGCTGGAATTTATC
rJMFF034C09+ AATGGATCCGCATCTGGGTGAAGAAAGGGGCAATGATTGTTCTGCCTGCTGGAATTTATC
rJMFF040K01+ AATGGATCCGCATCTGGGTGAAGAAAGGGGCAATGATTGTTCTGCCTGCTGGAATTTATC
rJMFF024O21+ AATGGATCCGCATCTGGGTGAAGAAAGGGGCAATGATTGTTCTGCCTGCTGGAATTTATC
JMFN009E01+ AATGGATCCGCATCTGGGTGAAGAAAGGGGCAATGATTGTTCTGCCTGCTGGAATTTATC
                      ____________________________________________________________
consensus AATGGATCCGCATCTGGGTGAAGAAAGGGGCAATGATTGTTCTGCCTGCTGGAATTTATC
 
. : . : . : . : . : . :
JMFF024O21- ACCGTTTTACCCTTGA
JMFF034C09- ACCGTTTTACCCTTGATTCAGA
JMFF012C02- ACCGTTTTACCCTTGATTCAGACAACTACATTAAGGCAATGAGGCTCTTTGTCGGTGACC
JMFN003F08- ACCGTTTTACCCTTGATTCAGACAACTACATTAAGGCAATGAGGCTCTTTGTCGGTGACC
rJMFF012C02+ ACCGTTTTACCCTTGATTCAGACAACTACATTAAGGCAATGAGGCTCTTTGTCGGTGACC
rJMSF001P08+ ACCGTTTTACCCTTGATTCAGACAACTACATTAAGGCAATGAGGCTCTTTGTCGGTGACC
rJMFF034C09+ ACCGTTTTACCCTTGATTCAGACAACTACATTAAGGCAATGAGGCTCTTTGTCGGTGACC
rJMFF040K01+ ACCGTTTTACCCTTGATTCAGACAACTACATTAAGGCAATGAGGCTCTTTGTCGGTGACC
rJMFF024O21+ ACCGTTTTACCCTTGATTCAGACAACTACATTAAGGCAATGAGGCTCTTTGTCGGTGACC
JMFN009E01+ ACCGTTTTACCCTTGATTCAGACAACTACATTAAGGCAATGAGGCTCTTTGTCGGTGACC
                      ____________________________________________________________
consensus ACCGTTTTACCCTTGATTCAGACAACTACATTAAGGCAATGAGGCTCTTTGTCGGTGACC
 
. : . : . : . : . : . :
JMFF012C02- CAGTCTGGACCCCATTCAACCGTCCACATGACCATCTCCCTGCNAGGAAAGAATACATTG
JMFN003F08- CAGTCTGGACCCCATTCAACCGTCCACATGACCATCTCCCTGCAAGGAAAGAATACATTG
rJMFF012C02+ CAGTCTGGACCCCATTCAACCGTCCACATGACCATCTCCCTGCAAGGAAAGAATACATTG
rJMSF001P08+ CAGTCTGGACCCCATTCAACCGTCCACATGACCATCTCCCTGCAAGGAAAGAATACATTG
rJMFF034C09+ CAGTCTGGACCCCATTCAACCGTCCACATGACCATCTCCCTGCAAGGAAAGAATACATTG
rJMFF040K01+ CAGTCTGGACCCCATTCAACCGTCCACATGACCATCTCCCTGCAAGGAAAGAATACATTG
rJMFF024O21+ CAGTCTGGACCCCATTCAACCGTCCACATGACCATCTCCCTGCAAGGAAAGAATACATTG
JMFN009E01+ CAGTCTGGACCCCATTCAACCGTCCACATGACCATCTCCCTGCAAGGAAAGAATACATTG
                      ____________________________________________________________
consensus CAGTCTGGACCCCATTCAACCGTCCACATGACCATCTCCCTGCAAGGAAAGAATACATTG
 
. : . : . : . : . : . :
JMFF012C02- AAACATTTGTGCA
JMFN003F08- AAACATTTGTGCAGAAGAATGATGGTACTGGCCATGCAGTTAATGCTGCTGCT
rJMFF012C02+ AAACATTTGTGCAGAAGAATGATGGTACTGGCCATGCAGTTAATGCTGCTGCTTAAGTAA
rJMSF001P08+ AAACATTTGTGCAGAAGAATGATGGTACTGGCCATGCAGTTAATGCTGCTGCTTAAGTAA
rJMFF034C09+ AAACATTTGTGCAGAAGAATGATGGTACTGGCCATGCAGTTAATGCTGCTGCTTAAGTAA
rJMFF040K01+ AAACATTTGTGCAGAAGAATGATGGTACTGGCCATGCAGTTAATGCTGCTGCTTAAGTAA
rJMFF024O21+ AAACATTTGTGCAGAAGAATGATGGTACTGGCCATGCAGTTAATGCTGCTGCTTAAGTAA
JMFN009E01+ AAACATTTGTGCAGAAGAATGATGGTACTGGCCATGCAGTTAATGCTGCTGCTTAAGTAA
                      ____________________________________________________________
consensus AAACATTTGTGCAGAAGAATGATGGTACTGGCCATGCAGTTAATGCTGCTGCTTAAGTAA
 
. : . : . : . : . : . :
rJMFF012C02+ ACTCCATAGCTGCTGCAGCTTTAATTTAACATTCTACCTATTATACAACCCAGAAATCTT
rJMSF001P08+ ACTCCATAGCTGCTGCAGCTTTAATTTAACATTCTACCTATTATACAACCCAGAAATCTT
rJMFF034C09+ ACTCCATAGCTGCTGCAGCTTTAATTTAACATTCTACCTATTATACAACCCAGAAATCTT
rJMFF040K01+ ACTCCATAGCTGCTGCAGCTTTAATTTAACATTCTACCTATTATACAACCCAGAAATCTT
rJMFF024O21+ ACTCCATAGCTGCTGCAGCTTTAATTTAACATTCTACCTATTATACAACCCAGAAATCTT
JMFN009E01+ ACTCCATAGCTGCTGCAGCTTTAATTTAACATTCTACCTATTATACAACCCAGAAATCTT
                      ____________________________________________________________
consensus ACTCCATAGCTGCTGCAGCTTTAATTTAACATTCTACCTATTATACAACCCAGAAATCTT
 
. : . : . : . : . : . :
rJMFF012C02+ AGACTATCCGATCTGGTAAATCTGTTATTGTGATAATATCATAATAAT
rJMSF001P08+ AGACTATCCGATCTGGTAAATCTGTTATTGTGATAATATCATAATAATCCCACCCTTGTT
rJMFF034C09+ AGACTATCCGATCTGGTAAATCTGTTATTGTGATAATATCATAATAATCCCACCCTTGTT
rJMFF040K01+ AGACTATCCGATCTGGTAAATCTGTTATTGTGATAATATCATAATAATCCCACCCTTGTT
rJMFF024O21+ AGACTATCCGATCTGGTAAATCTGTTATTGTGATAATATCATAATAATCCCACCCTTGTT
JMFN009E01+ AGACTATCCGATCTGGTAAATCTGTTATTGTGATAATATCATAATAATCCCACCCTTGTT
                      ____________________________________________________________
consensus AGACTATCCGATCTGGTAAATCTGTTATTGTGATAATATCATAATAATCCCACCCTTGTT
 
. : . : . : . : . : . :
rJMSF001P08+ GTATGGGTGACTGTTCTGTGTCTTTTGCTTCTGTT
rJMFF034C09+ GTATGGGTGACTGTTCTGTGTCTTTTGCTTCTGTTTGTACAATACCATATTCACTT
rJMFF040K01+ GTATGGGTGACTGTTCTGTGTCTTTTGCTTCTGTTTGTACAATACCATATTCAC
rJMFF024O21+ GTATGGGTGACTGTTCTGTGTCTTTTGCTTCTGTTTGTACAATACCATATTCACTT
JMFN009E01+ GTATGGGTGACTGTTCTGTGTCTTTTGCTTCTGTTTGTACAATACCATATTCACTTTATA
                      ____________________________________________________________
consensus GTATGGGTGACTGTTCTGTGTCTTTTGCTTCTGTTTGTACAATACCATATTCACTTTATA
 
. : . : . : . : . : . :
JMFN009E01+ ATAGTAATAACGGTGTTGGAATXXXXXXXXXXXXXXXXXXXXXXXXCTCGAGACTAGTTC
                      ____________________________________________________________
consensus ATAGTAATAACGGTGTTGGAATNNNNNNNNNNNNNNNNNNNNNNNNCTCGAGACTAGTTC