Previous Contig 002343:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN007D21Sequence396002343 (2)
JMFN009D21Sequence605002343 (2)gb:AF356001_17907408e-06Craterostigma plantagineum PTP-1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN009D21+ TCCACC
                      ____________________________________________________________
consensus TCCACC
 
. : . : . : . : . : . :
JMFN009D21+ AACTTCTCATCCACTTCCTCAACCTTGTCCATGAGGTCTTCCACTATATGAGCATCTTTA
                      ____________________________________________________________
consensus AACTTCTCATCCACTTCCTCAACCTTGTCCATGAGGTCTTCCACTATATGAGCATCTTTA
 
. : . : . : . : . : . :
JMFN009D21+ GCAGTTTCTTCGGCCAAATGTTCAATAGACTCAACTATGTCTTTGAGCCTGCCATCCGGT
                      ____________________________________________________________
consensus GCAGTTTCTTCGGCCAAATGTTCAATAGACTCAACTATGTCTTTGAGCCTGCCATCCGGT
 
. : . : . : . : . : . :
JMFN007D21+ TTCTCCACCACC
JMFN009D21+ AGCTTCACTTTAAAATCCTCCGCCGCCTTATCAACGTCATGCGCCACGTTCTCCACCACC
                      ____________________________________________________________
consensus AGCTTCACTTTAAAATCCTCCGCCGCCTTATCAACGTCATGCGCCACGTTCTCCACCACC
 
. : . : . : . : . : . :
JMFN007D21+ TCCGCCACTTTTTCCACCGCCTCCACCGCCGCCTCAACTTGCTTTGGCAATGCTATCAAC
JMFN009D21+ TCCGCCACTTTTTCCACCGCCTCCGCCGCCGCCTCAACTTGCTTTGACAATGCTATCAAC
                      ____________________________________________________________
consensus TCCGCCACTTTTTCCACCGCCTCCGCCGCCGCCTCAACTTGCTTTGGCAATGCTATCAAC
 
. : . : . : . : . : . :
JMFN007D21+ TGAGCAGTAACCAAGGGTAGTGACACCCCAAGTCCGACAGCCCAACCTAACCAAGAATTA
JMFN009D21+ TGAGCAGTAACCAAGGGTAGTGACACCCCAAGTCCGACAGCCCAACCTAACCAAGAATTA
                      ____________________________________________________________
consensus TGAGCAGTAACCAAGGGTAGTGACACCCCAAGTCCGACAGCCCAACCTAACCAAGAATTA
 
. : . : . : . : . : . :
JMFN007D21+ TCCGAGGGAGGCCAGAAGGGAAGAACGCCGGAAAGAAAGTCTCCGGCGGCGGCGGCTTCA
JMFN009D21+ TCCGAGGGAGGCCAGAAGGGAAGAACGCCGGAAAGAAAGTCTCCGGCGGCGGCGGCTTCA
                      ____________________________________________________________
consensus TCCGAGGGAGGCCAGAAGGGAAGAACGCCGGAAAGAAAGTCTCCGGCGGCGGCGGCTTCA
 
. : . : . : . : . : . :
JMFN007D21+ GGAGTGGCTTGAATGACCAAGGCCCTTTTGTTTGAGGATCTCTGGGAGATTTTGAGATTG
JMFN009D21+ GGAGTGGCTTGAATGACCAAGGCCCTTTTGTTTGAGGATCTCTGGGAGATTTTGAGATTG
                      ____________________________________________________________
consensus GGAGTGGCTTGAATGACCAAGGCCCTTTTGTTTGAGGATCTCTGGGAGATTTTGAGATTG
 
. : . : . : . : . : . :
JMFN007D21+ GTTGGGAATGGGAATCCATGATCATAGTCGTCATGGTTGTGTGTAGAAAAATGTTGTTGC
JMFN009D21+ GTTGGGAATGGGAATCCATGATCATAGTCGTCATGGTTGTGTGTAG-AAAATGTTGTTGC
                      ____________________________________________________________
consensus GTTGGGAATGGGAATCCATGATCATAGTCGTCATGGTTGTGTGTAGAAAAATGTTGTTGC
 
. : . : . : . : . : . :
JMFN007D21+ ATAGAAAAGTGGATTAAAACCCAAAGTTTGAGATCTGCTGTTCAAGGGAGTGAGGGTGGA
JMFN009D21+ ATAGAAAAGTGGATTAAAACCCAAAGTTTGAGATCTGCTGTTCAAGGGAGTGAGGGTGGA
                      ____________________________________________________________
consensus ATAGAAAAGTGGATTAAAACCCAAAGTTTGAGATCTGCTGTTCAAGGGAGTGAGGGTGGA
 
. : . : . : . : . : . :
JMFN007D21+ GAAGTTGGGAGAAAAAAAAGATGT
JMFN009D21+ GAAGTTGGGAGAAAAAAAAGATGTTGACATGGTGATTCTGAGTTTTTCCTTTTTTTCTCC
                      ____________________________________________________________
consensus GAAGTTGGGAGAAAAAAAAGATGTTGACATGGTGATTCTGAGTTTTTCCTTTTTTTCTCC