Previous Contig 002337:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN008L22Sequence616002337 (2)gb:AY050814_15623189e-18Arabidopsis thaliana unknown protein (At4g19160) mRNA, complete cds.>gb:AY091416
JMFS011A12Sequence351002337 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS011A12+ GATATGATTAAATAAGGTAGTATTATTTGATCTGCTAATTAA
                      ____________________________________________________________
consensus GATATGATTAAATAAGGTAGTATTATTTGATCTGCTAATTAA
 
. : . : . : . : . : . :
JMFS011A12+ ATAAAACATGGTTTTGAAAAATGAGAACATGCCTGCTGCAAGCATTTGAAGCTTGCATAT
                      ____________________________________________________________
consensus ATAAAACATGGTTTTGAAAAATGAGAACATGCCTGCTGCAAGCATTTGAAGCTTGCATAT
 
. : . : . : . : . : . :
JMFS011A12+ CTCCTCGTACATGTCTCTTCTCCAAAACCTTAAAATCAAACATGGCTTAAACAGAAATTT
JMFN008L22+ GCTTAAACAGAAATTT
                      ____________________________________________________________
consensus CTCCTCGTACATGTCTCTTCTCCAAAACCTTAAAATCAAACATGGCTTAAACAGAAATTT
 
. : . : . : . : . : . :
JMFS011A12+ ACAGAAGCCAGGTTACAGCCAAAGTTACAATGCTTTCAATGTCAGAACTACTGAAAAGCT
JMFN008L22+ ACAGAAGCCAGGTTACAGCCAAAGTTACAATGCTTTTAATGTCAGAACTACTGAAAAGCT
                      ____________________________________________________________
consensus ACAGAAGCCAGGTTACAGCCAAAGTTACAATGCTTTTAATGTCAGAACTACTGAAAAGCT
 
. : . : . : . : . : . :
JMFS011A12+ TCATTCTCCACCCGCTTTTGCAGAAACAAGTCAAGGAACTGTTAGCCGGCCTTCTTTATG
JMFN008L22+ TCATTCTCCACCCGCTTTTGCAGAAACAAGTCAAGGAACTGTTAGCCGGCCTTCTTTATG
                      ____________________________________________________________
consensus TCATTCTCCACCCGCTTTTGCAGAAACAAGTCAAGGAACTGTTAGCCGGCCTTCTTTATG
 
. : . : . : . : . : . :
JMFS011A12+ CCCCAACGATTTCCACGAAGATTCAACCTGCATCAGGTGCAGCTTCTCGACGAATGGCTC
JMFN008L22+ CCCCAACGATTTCCACGAAGATTCAACCTGCATCAGGTGCAGCTTCTCGACGAATGGCTC
                      ____________________________________________________________
consensus CCCCAACGATTTCCACGAAGATTCAACCTGCATCAGGTGCAGCTTCTCGACGAATGGCTC
 
. : . : . : . : . : . :
JMFS011A12+ CAGAACTTC
JMFN008L22+ CAGAACTTCTGCCTCTTCTTCCGGGGCAAACGCCATGCAAATGCTAAGCTCCTGGACTGC
                      ____________________________________________________________
consensus CAGAACTTCTGCCTCTTCTTCCGGGGCAAACGCCATGCAAATGCTAAGCTCCTGGACTGC
 
. : . : . : . : . : . :
JMFN008L22+ AGCCGCATATTCCCTGCTGTAGTAGAGCATGAGGCCGTGGTCTCTTCTTAGAATCCAGTT
                      ____________________________________________________________
consensus AGCCGCATATTCCCTGCTGTAGTAGAGCATGAGGCCGTGGTCTCTTCTTAGAATCCAGTT
 
. : . : . : . : . : . :
JMFN008L22+ GTGTGGCTGCAGAATCAGCAGTCTTTCTGAAGCCATAATAGCCAGCCTAGAAAGTAATGT
                      ____________________________________________________________
consensus GTGTGGCTGCAGAATCAGCAGTCTTTCTGAAGCCATAATAGCCAGCCTAGAAAGTAATGT
 
. : . : . : . : . : . :
JMFN008L22+ CATGGTTAAGCGACATTCAAACTAGACAGTCTAAATCCCAAGAACAGGTGTCAGAAAACC
                      ____________________________________________________________
consensus CATGGTTAAGCGACATTCAAACTAGACAGTCTAAATCCCAAGAACAGGTGTCAGAAAACC
 
. : . : . : . : . : . :
JMFN008L22+ CGTGGATATTATCAAACAATCAAGGCAATCTGATACCATAGATTAGCGTTACATATAAAC
                      ____________________________________________________________
consensus CGTGGATATTATCAAACAATCAAGGCAATCTGATACCATAGATTAGCGTTACATATAAAC
 
. : . : . : . : . : . :
JMFN008L22+ TAGCTAGCAGTTCAGGCTGCAGATCAGACAATAGTCAAATAAAGTAACCAAATATCTCCT
                      ____________________________________________________________
consensus TAGCTAGCAGTTCAGGCTGCAGATCAGACAATAGTCAAATAAAGTAACCAAATATCTCCT
 
. : . : . : . : . : . :
JMFN008L22+ GCTTGTTAGATAAAAGCGCAATGCACATATACAAGTAATGTTATGGGAACTTCAACTTTT
                      ____________________________________________________________
consensus GCTTGTTAGATAAAAGCGCAATGCACATATACAAGTAATGTTATGGGAACTTCAACTTTT