Previous Contig 002336:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN008J21Sequence607002336 (2)gb:IBA6097_16829513e-61Ipomoea batatas mRNA for catechol oxidase, partial.
JMSF003F11Sequence386002336 (2)gb:IBA6097_16829511e-43Ipomoea batatas mRNA for catechol oxidase, partial.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN008J21+ TGGCTCG
                      ____________________________________________________________
consensus TGGCTCG
 
. : . : . : . : . : . :
JMFN008J21+ ACTCCAAGCCAGTTCCCACCAAGAAAAAGGGCGGCTACGCCGCCAAGTCTAAGGCACCCT
                      ____________________________________________________________
consensus ACTCCAAGCCAGTTCCCACCAAGAAAAAGGGCGGCTACGCCGCCAAGTCTAAGGCACCCT
 
. : . : . : . : . : . :
JMFN008J21+ TCGTCACCAGCGTCTTCCCCGTCACGCTCGACAAGGTTGTCCAGGTCAAGGTTGCTCGGC
                      ____________________________________________________________
consensus TCGTCACCAGCGTCTTCCCCGTCACGCTCGACAAGGTTGTCCAGGTCAAGGTTGCTCGGC
 
. : . : . : . : . : . :
JMFN008J21+ CCAAGAAGTCCAGGAGGGCAGAGGAGAAAGAGGCGGAAGAAGAAATCTTGCTCATAGAAG
                      ____________________________________________________________
consensus CCAAGAAGTCCAGGAGGGCAGAGGAGAAAGAGGCGGAAGAAGAAATCTTGCTCATAGAAG
 
. : . : . : . : . : . :
JMFN008J21+ GCATTGAGGTGGCCATTGACAAGTACGCCAAGTTCGACGTTTACCTGAACGACGAGGACG
                      ____________________________________________________________
consensus GCATTGAGGTGGCCATTGACAAGTACGCCAAGTTCGACGTTTACCTGAACGACGAGGACG
 
. : . : . : . : . : . :
JMFN008J21+ ACCCCAGCGGCGGCAAAGACAAGGCGGAGTACGCCGGGAGCTTTGCGCATCTCCCCCACA
                      ____________________________________________________________
consensus ACCCCAGCGGCGGCAAAGACAAGGCGGAGTACGCCGGGAGCTTTGCGCATCTCCCCCACA
 
. : . : . : . : . : . :
JMSF003F11+ GAAGAAGATCAGGACTACTCTCAGCCTGGGTCTGAATGAGCCGCTGG
JMFN008J21+ AGCACAAGGGGATGAAGAAGATCAGGACTACTCTCAGCCTGGGTCTGAATGAGCCGCTGG
                      ____________________________________________________________
consensus AGCACAAGGGGATGAAGAAGATCAGGACTACTCTCAGCCTGGGTCTGAATGAGCCGCTGG
 
. : . : . : . : . : . :
JMSF003F11+ AGGATTTGGGCGCCGAGGACGACGACGATATTCTGGTGACTTTGGCTCCAAAAGTTGGCG
JMFN008J21+ AGGATTTGGGCGCCGAGGACGACGACGATATTCTGGTGACTTTGGCTCCAAAAGTTGGCG
                      ____________________________________________________________
consensus AGGATTTGGGCGCCGAGGACGACGACGATATTCTGGTGACTTTGGCTCCAAAAGTTGGCG
 
. : . : . : . : . : . :
JMSF003F11+ GCGGCGTTGTCTCCGTCGACAACATCAAGATCGTCTACGGCTCTTAGA
JMFN008J21+ GCGGCGTTGTCTCCGTCGACAACATCAAGATCGTCTACGGCTCTTAGAATGCCATGCCGC
                      ____________________________________________________________
consensus GCGGCGTTGTCTCCGTCGACAACATCAAGATCGTCTACGGCTCTTAGAATGCCATGCCGC
 
. : . : . : . : . : . :
JMFN008J21+ CGCCGCCGACGTCGTAATCTGTCGAAATTAAATAATTCCGGTCAATCGTCGATGGATCGT
                      ____________________________________________________________
consensus CGCCGCCGACGTCGTAATCTGTCGAAATTAAATAATTCCGGTCAATCGTCGATGGATCGT
 
. : . : . : . : . : . :
JMFN008J21+ TTGTACTGTTAGGCTCCCCTCCGAATAAGACTTTTCTCACAAACTAAAGGGTCGTCCCAT
                      ____________________________________________________________
consensus TTGTACTGTTAGGCTCCCCTCCGAATAAGACTTTTCTCACAAACTAAAGGGTCGTCCCAT