Previous Contig 002334:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN008I02Sequence619002334 (2)gb:AF530163_18090655e-88Lactuca sativa eukaryotic translation initiation factor iso4E (eIF(iso)4E) mRNA,
JMFN028J09Sequence588002334 (2)gb:AF530163_18090652e-86Lactuca sativa eukaryotic translation initiation factor iso4E (eIF(iso)4E) mRNA,

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN028J09+ TGACCTTTCCCTTTT
JMFN008I02+ TAGCTGACCTTTCCCTTTT
                      ____________________________________________________________
consensus TAGCTGACCTTTCCCTTTT
 
. : . : . : . : . : . :
JMFN028J09+ AGAATCATCATGGAAGCTATAGGATAGCTTATCGGTTACATCAATGACCTCTTTCCACTT
JMFN008I02+ AGAATCATCATGGAAGCTATAGGATAGCTTATCGGTTACATCAATGACCTCTTTCCACTT
                      ____________________________________________________________
consensus AGAATCATCATGGAAGCTATAGGATAGCTTATCGGTTACATCAATGACCTCTTTCCACTT
 
. : . : . : . : . : . :
JMFN028J09+ CCTCCCAATGCTCATCTGAGCCGCTTCATTGGCTGCATTTTTGGTCCACAAAGAAAGTCT
JMFN008I02+ CCTCCCAATGCTCATCTGAGCCGCTTCATTGGCTGCATTTTTGGTCCACAAAGAAAGTCT
                      ____________________________________________________________
consensus CCTCCCAATGCTCATCTGAGCCGCTTCATTGGCTGCATTTTTGGTCCACAAAGAAAGTCT
 
. : . : . : . : . : . :
JMFN028J09+ GTCCTGTCTCTGACGCACACTGGCAACCACTCCACAGATCTCCTCTGCTTCATCAAATTG
JMFN008I02+ GTCCTGTCTCTGACGCACACTGGCAACCACTCCACAGATCTCCTCTGCTTCATCAAATTG
                      ____________________________________________________________
consensus GTCCTGTCTCTGACGCACACTGGCAACCACTCCACAGATCTCCTCTGCTTCATCAAATTG
 
. : . : . : . : . : . :
JMFN028J09+ CTCCCCAATCAAAGCCATCAGAGTTTCAAGCTACATGGTGTCAAGAGTTGCCTTCCTGCT
JMFN008I02+ CTCCCCAATCAAAGCCATCAGAGTTTCAAGCCACATGGTGTCAAGAGTTGCCTTCCTGCT
                      ____________________________________________________________
consensus CTCCCCAATCAAAGCCATCAGAGTTTCAAGCTACATGGTGTCAAGAGTTGCCTTCCTGCT
 
. : . : . : . : . : . :
JMFN028J09+ GCTGCTGACAGTCCACTTGCCTCCATTGGCACACTCAGGATCTTCCCATTTTGGCTCAAT
JMFN008I02+ GCTGCTGACAGTCCACTTGCCTCCATTGGCACACTCAGGATCTTCCCATTTTGGCTCAAT
                      ____________________________________________________________
consensus GCTGCTGACAGTCCACTTGCCTCCATTGGCACACTCAGGATCTTCCCATTTTGGCTCAAT
 
. : . : . : . : . : . :
JMFN028J09+ CCCAGCTTTAAACAAATGAAAATCAGCATTTGCAGGCAATTGGCTGGGCCTAAATATCTG
JMFN008I02+ CCCAGCTTTAAACAAATGAAAATCAGCATTTGCAGGCAATTGGCTGGGCCTAAATATCTG
                      ____________________________________________________________
consensus CCCAGCTTTAAACAAATGAAAATCAGCATTTGCAGGCAATTGGCTGGGCCTAAATATCTG
 
. : . : . : . : . : . :
JMFN028J09+ ATCATACAAGCACCAGAATTCTTCAACGGTGTCGAAAGTGTAGACCTTACGCATAGAGCT
JMFN008I02+ ATCATACAAGCACCAGAATTCTTCAACGGTGTCGAAAGTGTAGACCTTACGCATAGAGCT
                      ____________________________________________________________
consensus ATCATACAAGCACCAGAATTCTTCAACGGTGTCGAAAGTGTAGACCTTACGCATAGAGCT
 
. : . : . : . : . : . :
JMFN028J09+ GCCCCAGGCGGCGCCTTGCTTAGGCTTTGACTGGTTGTCAAACCAGAAGGCCCATTTCCT
JMFN008I02+ GCCCCAGGCGGCGCCTTGCTTAGGCTTTGACTGGTTGTCAAACCAGAAGGCCCATTTCCT
                      ____________________________________________________________
consensus GCCCCAGGCGGCGCCTTGCTTAGGCTTTGACTGGTTGTCAAACCAGAAGGCCCATTTCCT
 
. : . : . : . : . : . :
JMFN028J09+ CTCCAATTTGTGCGGCTGTTTGGACGCCGTCTCGGTCACCGTTGCCGCAGGAGCCTCCGT
JMFN008I02+ CTCCAATTTGTGCGGCTGTTTGGACGCCGTCTCGGTCACCGTTGCCGCAGGAGCCTCCGT
                      ____________________________________________________________
consensus CTCCAATTTGTGCGGCTGTTTGGACGCCGTCTCGGTCACCGTTGCCGCAGGAGCCTCCGT
 
. : . : . : . : . : . :
JMFN028J09+ CAATTCCGCTGCCGTCTCGGTTGCCATTTCGT
JMFN008I02+ CAATTCCGCTGCCGTCTCGGTTGCCATTTCGTGATATAGATCTCTGGTTCCAGAATCAGA
                      ____________________________________________________________
consensus CAATTCCGCTGCCGTCTCGGTTGCCATTTCGTGATATAGATCTCTGGTTCCAGAATCAGA