Previous Contig 002330:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN008C04Sequence554002330 (3)pir|G86174|G861742e-12hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889449 Arabid
JMFN012D14Sequence557002330 (3)pir|G86174|G861742e-12hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889449 Arabid
JMFN031J02Sequence570002330 (3)pir|G86174|G861742e-12hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889449 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN031J02+ AGGGGTAGAACTGGGAAACTATGAACATTAGGGGTAT
                      ____________________________________________________________
consensus AGGGGTAGAACTGGGAAACTATGAACATTAGGGGTAT
 
. : . : . : . : . : . :
JMFN031J02+ TCCGTCAGAATTGCAATCAAAAATTAAAATGAAAAAAAAAAAAAAAAAGGAAATAAAAAA
JMFN012D14+ GGAAATACAAAA
JMFN008C04+ GGAAATACAAAA
                      ____________________________________________________________
consensus TCCGTCAGAATTGCAATCAAAAATTAAAATGAAAAAAAAAAAAAAAAAGGAAATACAAAA
 
. : . : . : . : . : . :
JMFN031J02+ TTTAGATTTCAGATAACCGTCTGCGTTTGGATCTAGATCATCTATCGGCTTTTCCTGTAC
JMFN012D14+ TTTAGATTTCAGATAACCGTCTGCGTTTGGATCTAGATCATCTATCGGCTTTTCCTGTAC
JMFN008C04+ TTTAGATTTCAGATAACCGTCTGCGTTTGGATCTAGATCATCTATCGGCTTTTCCTGTAC
                      ____________________________________________________________
consensus TTTAGATTTCAGATAACCGTCTGCGTTTGGATCTAGATCATCTATCGGCTTTTCCTGTAC
 
. : . : . : . : . : . :
JMFN031J02+ AAACGAACTGAAGAAACGGAGCCGGATCGTAGGAGAACGGCGCCGCCGGGTGTTGCCACT
JMFN012D14+ AAACGAACTGAAGAAACGGAGCCGGATCGTAGGAGAACGGCGCCGCCGGGTGTTGCCACT
JMFN008C04+ AAAAGAACTGAAGAAACGGAGCCGGATCGTAGGAGAACGGCGCCGCCGGGTGTTGCCACT
                      ____________________________________________________________
consensus AAACGAACTGAAGAAACGGAGCCGGATCGTAGGAGAACGGCGCCGCCGGGTGTTGCCACT
 
. : . : . : . : . : . :
JMFN031J02+ TCTTAAACACCACCGTCTGCGGCTTCTCCGCCTCTCTGCTCTCGTCCTTCTTACTGCTCG
JMFN012D14+ TCTTAAACACCACCGTCTGCGGCTTCTCCGCCTCTCTGCTCTCGTCCTTCTTACTGCTCG
JMFN008C04+ TCTTAAACACCACCGTCTGCGGCTTCTCCGCCTCTCTGCTCTCGTCCTTCTTACTGCTCG
                      ____________________________________________________________
consensus TCTTAAACACCACCGTCTGCGGCTTCTCCGCCTCTCTGCTCTCGTCCTTCTTACTGCTCG
 
. : . : . : . : . : . :
JMFN031J02+ AGTTCGAACACGACTTGATCGCCGCCGTTAAATCGCTCGAATCCGGCGACGTAATCAGCG
JMFN012D14+ AGTTCGAACACGACTTGATCGCCGCCGTTAAATCGCTCGAATCCGGCGACGTAATCAGCG
JMFN008C04+ AGTTCGAACACGACTTGATCGCCGCCGTTAAATCGCTCGAATCCGGCGACGTAATCAGCG
                      ____________________________________________________________
consensus AGTTCGAACACGACTTGATCGCCGCCGTTAAATCGCTCGAATCCGGCGACGTAATCAGCG
 
. : . : . : . : . : . :
JMFN031J02+ GCGATAGCAGCGGTATGGCCACATTCCAATCCGTCGAGCGGTTTATCTGGATCGACGCCG
JMFN012D14+ GCGATAGCAGCGGTATGGCCACATTCCAATCCGTCGAGCGGTTTATCTGGATCGACGCCG
JMFN008C04+ GCGATAGCAGCGGTATGGCCACATTCCAATCCGTCGAGCGGTTTATCTGGATCGACGCCG
                      ____________________________________________________________
consensus GCGATAGCAGCGGTATGGCCACATTCCAATCCGTCGAGCGGTTTATCTGGATCGACGCCG
 
. : . : . : . : . : . :
JMFN031J02+ GCGCTTTCCGCTGCAATCGGCTCGACTGCCGCCGGTCCCCTGACAAATATTTCTTGTTCT
JMFN012D14+ GCGCTTTCCGCTGCAATCGGCTCGACTGCCGCCGGTCCCCTGACAAATATTTCTTGTTCT
JMFN008C04+ GCGCTTTCCGCTGCAATCGGCTCGACTGCCGCCGGTCCCCTGACAAATATTTCTTGTTCT
                      ____________________________________________________________
consensus GCGCTTTCCGCTGCAATCGGCTCGACTGCCGCCGGTCCCCTGACAAATATTTCTTGTTCT
 
. : . : . : . : . : . :
JMFN031J02+ CCGCCATAACCGTATATGCGAGGACTGTAGAGACTAGAGAGAGAAACGTGCACAGTATAT
JMFN012D14+ CCGCCATAACCGTATATGCGAGGACTGTAGAGACTAGAGAGAGAAACGTGCACAGTATAT
JMFN008C04+ CCGCCATAACCGTATATGCGAGGACTGTAGAGACTAGAGAGAGAAACGTGCACAGTATAT
                      ____________________________________________________________
consensus CCGCCATAACCGTATATGCGAGGACTGTAGAGACTAGAGAGAGAAACGTGCACAGTATAT
 
. : . : . : . : . : . :
JMFN031J02+ TTTGCTTTAGAGAGAGAAAATTTAGGGATTTGGTGAGAGAGAGAGAGAAGAGG
JMFN012D14+ TTTGCTTTAGAGAGAGAAAATTTAGGGATTTGGTGAGAGAGAGAGAGAAGAGG
JMFN008C04+ TTTGCTTTAGAGAGAGAAAATTTAGGGATTTGGTGAGAGAGAGAGAGAAGAGGGAAGTGT
                      ____________________________________________________________
consensus TTTGCTTTAGAGAGAGAAAATTTAGGGATTTGGTGAGAGAGAGAGAGAAGAGGGAAGTGT