Previous Contig 002324:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013N19Sequence563002324 (3)sp|P59234|YIPL_SOLTU2e-15Yippee-like protein.>gb:AB061267_1522028 Solanum tuberosum mRNA for yippee-like 589002324 (3)sp|P59234|YIPL_SOLTU8e-31Yippee-like protein.>gb:AB061267_1522028 Solanum tuberosum mRNA for yippee-like
JMFN007M16Sequence612002324 (3)sp|P59234|YIPL_SOLTU2e-15Yippee-like protein.>gb:AB061267_1522028 Solanum tuberosum mRNA for yippee-like

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF013N19- ATTATCCAG
                      ____________________________________________________________
consensus ATTATCCAG
 
. : . : . : . : . : . :
rJMFF013N19- AGTTTTGAAACATGGGAATAGACAATTCCAGGATACAATAGTTCAATGAGAAGAATGGGG
                      ____________________________________________________________
consensus AGTTTTGAAACATGGGAATAGACAATTCCAGGATACAATAGTTCAATGAGAAGAATGGGG
 
. : . : . : . : . : . :
rJMFF013N19- GTGGGTTGAGAATGTACAGTTGAGGATAGAATATATGATCTTAAGAGGTGATGATCAGAC
                      ____________________________________________________________
consensus GTGGGTTGAGAATGTACAGTTGAGGATAGAATATATGATCTTAAGAGGTGATGATCAGAC
 
. : . : . : . : . : . :
rJMFF013N19- ATAATCAGGGCCAACTCCTTCATGGCTTGTCCAGTAGCTGCTTCCATCAGGGCCAGCAAC
                      ____________________________________________________________
consensus ATAATCAGGGCCAACTCCTTCATGGCTTGTCCAGTAGCTGCTTCCATCAGGGCCAGCAAC
 
. : . : . : . : . : . :
rJMFF013N19- CTTAAACCGCTCAAGGACCGATTTCCCTTCTTTGTACTTCTGATTCTTCTCGTGAGCCAT
JMFF013N19+ ATTCTTCTCGTGAGCCAT
                      ____________________________________________________________
consensus CTTAAACCGCTCAAGGACCGATTTCCCTTCTTTGTACTTCTGATTCTTCTCGTGAGCCAT
 
. : . : . : . : . : . :
rJMFF013N19- TTCGTATTTCCAGCCAACAATCGACCCACATTTGACGCAGAAAATGTCTGCAACGGTGTG
JMFF013N19+ TTCGTATTTCCAGCCAACAATCGACCCACATTTGACGCAGAAAATGTCTGCAACGGTGTG
JMFN007M16+ TGCAACGGTGTG
                      ____________________________________________________________
consensus TTCGTATTTCCAGCCAACAATCGACCCACATTTGACGCAGAAAATGTCTGCAACGGTGTG
 
. : . : . : . : . : . :
rJMFF013N19- CATACCGGTCATCATCATCCTATCTTCGTTCGGGCCAGAAGTGACATTCACTCTGTCAAT
JMFF013N19+ CATACCGGTCATCATCATCCTATCTTCGTTCGGGCCAGAAGTGACATTCACTCTGTCAAT
JMFN007M16+ CATACCGGTCATCATCATCCTATCTTCGTTCGGGCCAGAAGTGACATTCACTCTGTCAAT
                      ____________________________________________________________
consensus CATACCGGTCATCATCATCCTATCTTCGTTCGGGCCAGAAGTGACATTCACTCTGTCAAT
 
. : . : . : . : . : . :
rJMFF013N19- TTAAATTTCAGCTTCCACAACACATATATAAGAGTTAAAAACAACGTTTTCTTTTGATTT
JMFF013N19+ TTAAATTTCAGCTTCCACAACACATATATAAGAGTTAAAAACAACGTTTTCTTTTGATTT
JMFN007M16+ TTAAATTTCAGCTTCCACAACACATATATAAGAGTTAAAAACAACGTTTTCTTTTGATTT
                      ____________________________________________________________
consensus TTAAATTTCAGCTTCCACAACACATATATAAGAGTTAAAAACAACGTTTTCTTTTGATTT
 
. : . : . : . : . : . :
rJMFF013N19- CTATCAATACAATGCAATAAAAGATGCTCGATTGTTTTCGACTACTCAACTATGTTGTTA
JMFF013N19+ CTATCAATACAATGCAATAAAAGATGCTCGATTGTTTTCGACTACTCAACTATGTTGTTA
JMFN007M16+ CTATCAATACAATGCAATAAAAGATGCTCGATTGTTTTCGACTACTCAACTATGTTGTTA
                      ____________________________________________________________
consensus CTATCAATACAATGCAATAAAAGATGCTCGATTGTTTTCGACTACTCAACTATGTTGTTA
 
. : . : . : . : . : . :
rJMFF013N19- TGCTTCCAAGATCAAGAAAATATATGATCATTCCAATGCATGAGCGGTCTGCTATACTAT
JMFF013N19+ TGCTTCCAAGATCAAGAAAATATATGATCATTCCAATGCATGAGCGGTCTGCTATACTAT
JMFN007M16+ TGCTTCCAAGATCAAGAAAATATATGATCATTCCAATGCATGAGCGGTCTGCTATACTAT
                      ____________________________________________________________
consensus TGCTTCCAAGATCAAGAAAATATATGATCATTCCAATGCATGAGCGGTCTGCTATACTAT
 
. : . : . : . : . : . :
rJMFF013N19- AATGTCACCACATTCACGAAAATCTTTGATCTATTTTTTG
JMFF013N19+ AATGTCACCACATTCACGAAAATCTTTGATCTATTTTTTGAGTGAGCAGAATCAAGGAGA
JMFN007M16+ AATGTCACCACATTCACGAAAATCTTTGATCTATTTTTTGAGTGAGCAGAATCAAGGAGA
                      ____________________________________________________________
consensus AATGTCACCACATTCACGAAAATCTTTGATCTATTTTTTGAGTGAGCAGAATCAAGGAGA
 
. : . : . : . : . : . :
JMFF013N19+ CTTACACCTTACTGAAGAGATAAGCCTTCCCGTGTCTGCAGTAAAAAGACTTGGAGACTA
JMFN007M16+ CTTACACCTTACTGAAGAGATAAGCCTTCCCGTGTCTGCAGTAAAAAGACTTGGAGACTA
                      ____________________________________________________________
consensus CTTACACCTTACTGAAGAGATAAGCCTTCCCGTGTCTGCAGTAAAAAGACTTGGAGACTA
 
. : . : . : . : . : . :
JMFF013N19+ TGTGGTCAGAAAGAGCAAGATGAGTTCCACAGTGCTTGCAGCTATAGA
JMFN007M16+ TGTGGTCAGAAAGAGCAAGATGAGTTCCACAGTGCTTGCAGCTATAGATCTTTCCTTCGA
                      ____________________________________________________________
consensus TGTGGTCAGAAAGAGCAAGATGAGTTCCACAGTGCTTGCAGCTATAGATCTTTCCTTCGA
 
. : . : . : . : . : . :
JMFN007M16+ GAGTGGATACAAACAGCCTCCCCATCTCTCTTCTTCTTCTTCTGTCAATCAAACGAAGAA
                      ____________________________________________________________
consensus GAGTGGATACAAACAGCCTCCCCATCTCTCTTCTTCTTCTTCTGTCAATCAAACGAAGAA
 
. : . : . : . : . : . :
JMFN007M16+ AGAACAAATAAAACCGTGAAGTTTAAGGAAAATAATAGGAATGGGTACCCAGAAAACCGA
                      ____________________________________________________________
consensus AGAACAAATAAAACCGTGAAGTTTAAGGAAAATAATAGGAATGGGTACCCAGAAAACCGA
 
. : . : . : . : . : . :
JMFN007M16+ TCAACAAATGATCTGGGTCAGATACTTGGATTGACGGTGAGTGACGTGAACGTAAGAAAA
                      ____________________________________________________________
consensus TCAACAAATGATCTGGGTCAGATACTTGGATTGACGGTGAGTGACGTGAACGTAAGAAAA