Previous Contig 002320:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030G14Sequence737002320 (3)pir|C86288|C862886e-70hypothetical protein F9L1.32 - Arabidopsis thaliana>gb:AE005172_890535 Arabidops
JMFN007J06Sequence618002320 (3)pir|C86288|C862885e-70hypothetical protein F9L1.32 - Arabidopsis thaliana>gb:AE005172_890535 Arabidops
JMFN035O20Sequence625002320 (3)pir|C86288|C862885e-70hypothetical protein F9L1.32 - Arabidopsis thaliana>gb:AE005172_890535 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF030G14- ATTGTTTTCTGCCTTTCCGGATAA
                      ____________________________________________________________
consensus ATTGTTTTCTGCCTTTCCGGATAA
 
. : . : . : . : . : . :
rJMFF030G14- CAAGTCAAATTCAAAATGATAAGGCAGAGCATTTGAACTAAAGTACAGAGTAGTACAGAA
                      ____________________________________________________________
consensus CAAGTCAAATTCAAAATGATAAGGCAGAGCATTTGAACTAAAGTACAGAGTAGTACAGAA
 
. : . : . : . : . : . :
rJMFF030G14- GTGGCTGTAATTTAGAACTGGTAACAATGTCACAAGCAAAAGTACTACTGCATATCTATC
JMFN035O20+ AAGCAAAAGTACTACTGCATATCTATC
JMFN007J06+ TACTACTGCATATCTATC
                      ____________________________________________________________
consensus GTGGCTGTAATTTAGAACTGGTAACAATGTCACAAGCAAAAGTACTACTGCATATCTATC
 
. : . : . : . : . : . :
rJMFF030G14- AACTTGTAGAAACTCATTCCTGAAGTTATACAACAAGGGAGAATGCGATGAATGGAAGGG
JMFN035O20+ AACTTGTAGAAACTCATTCCTGAAGTTATACAACAAGGGAGAATGCGATGAATGGAAGGG
JMFN007J06+ AACTTGTAGAAACTCATTCCTGAAGTTATACAACAAGGGAGAATGCGATGAATGGAAGGG
                      ____________________________________________________________
consensus AACTTGTAGAAACTCATTCCTGAAGTTATACAACAAGGGAGAATGCGATGAATGGAAGGG
 
. : . : . : . : . : . :
rJMFF030G14- AGAACACGATGAACGGAAGGGAGAACGCGATAATCATTGCTCAGAACTCGACAGGCGGCT
JMFN035O20+ AGAACACGATGAACGGAAGGGAGAACGCGATAATCATTGCTCAGAACTCGACAGGCGGCT
JMFN007J06+ AGAACACGATGAACGGAAGGGAGAACGCGATAATCATTGCTCAGAACTCGACAGGCGGCT
                      ____________________________________________________________
consensus AGAACACGATGAACGGAAGGGAGAACGCGATAATCATTGCTCAGAACTCGACAGGCGGCT
 
. : . : . : . : . : . :
rJMFF030G14- TCAACCTTATAAGTCGTTTGATTCTTTCTTTCTCAGTGTTTTCCAGCAGCCCCTTCCACA
JMFN035O20+ TCAACCTTATAAGTCGTTTGATTCTTTCTTTCTCAGTGTTTTCCAGCAGCCCCTTCCACA
JMFN007J06+ TCAACCTTATAAGTCGTTTGATTCTTTCTTTCTCAGTGTTTTCCAGCAGCCCCTTCCACA
                      ____________________________________________________________
consensus TCAACCTTATAAGTCGTTTGATTCTTTCTTTCTCAGTGTTTTCCAGCAGCCCCTTCCACA
 
. : . : . : . : . : . :
rJMFF030G14- CAATCTCATCCAGGCATAGGCAAATCTTTCCATACTTGTCCAAGAAAAGGCGCTCAGTTG
JMFN035O20+ CAATCTCATCCAGGCATAGGCAAATCTTTCCATACTTGTCCAAGAAAAGGCGCTCAGTTG
JMFN007J06+ CAATCTCATCCAGGCATAGGCAAATCTTTCCATACTTGTCCAAGAAAAGGCGCTCAGTTG
                      ____________________________________________________________
consensus CAATCTCATCCAGGCATAGGCAAATCTTTCCATACTTGTCCAAGAAAAGGCGCTCAGTTG
 
. : . : . : . : . : . :
rJMFF030G14- GAGGTTTTCCACACACATCCTTAATGCCCGATGTTATGACGAAGATTGCTTCAGACAAGG
JMFN035O20+ GAGGTTTTCCACACACATCCTTAATGCCCGATGTTATGACGAAGATTGCTTCAGACAAGG
JMFN007J06+ GAGGTTTTCCACACACATCCTTAATGCCCGATGTTATGACGAAGATTGCTTCAGACAAGG
                      ____________________________________________________________
consensus GAGGTTTTCCACACACATCCTTAATGCCCGATGTTATGACGAAGATTGCTTCAGACAAGG
 
. : . : . : . : . : . :
rJMFF030G14- CAAGTTCATCATACTCATCCTTGCCAACAACATAAATGCTGACATCCCCCAGCACCGTGT
JMFN035O20+ CAAGTTCATCATACTCATCCTTGCCAACAACATAAATGCTGACATCCCCCAGCACCGTGT
JMFN007J06+ CAAGTTCATCATACTCATCCTTGCCAACAACATAAATGCTGACATCCCCCAGCACCGTGT
                      ____________________________________________________________
consensus CAAGTTCATCATACTCATCCTTGCCAACAACATAAATGCTGACATCCCCCAGCACCGTGT
 
. : . : . : . : . : . :
rJMFF030G14- ACACAATATAAACTGATTTGTGACAAGCAACAAGAAGCTCTTCATTCTTTGTGCCTTTAA
JMFN035O20+ ACACAATATAAACTGATTTGTGACAAGCAACAAGAAGCTCTTCATTCTTTGTGCCTTTAA
JMFN007J06+ ACACAATATAAACTGATTTGTGACAAGCAACAAGAAGCTCTTCATTCTTTGTGCCTTTAA
                      ____________________________________________________________
consensus ACACAATATAAACTGATTTGTGACAAGCAACAAGAAGCTCTTCATTCTTTGTGCCTTTAA
 
. : . : . : . : . : . :
rJMFF030G14- GATTATCTGCACCCAGCTTAACTAGGAAAGACCGCCAATGCAAACGCTCTTCTGCTGGGA
JMFN035O20+ GATTATCTGCACCCAGCTTAACTAGGAAAGACCGCCAATGCAAACGCTCTTCTGCTGGGA
JMFN007J06+ GATTATCTGCACCCAGCTTAACTAGGAAAGACCGCCAATGCAAACGCTCTTCTGCTGGGA
                      ____________________________________________________________
consensus GATTATCTGCACCCAGCTTAACTAGGAAAGACCGCCAATGCAAACGCTCTTCTGCTGGGA
 
. : . : . : . : . : . :
rJMFF030G14- CACCATTAAATCGTTCGACGAGAATGTTCCCCTCGGAGTTAGCAATCAACACAGCCAGCA
JMFN035O20+ CACCATTAAATCGTTCGACGAGAATGTTCCCCTCGGAGTTAGCAATCAACACAGCCAGCA
JMFN007J06+ CACCATTAAATCGTTCGACGAGAATGTTCCCCTCGGAGTTAGCAATCAACACAGCCAGCA
                      ____________________________________________________________
consensus CACCATTAAATCGTTCGACGAGAATGTTCCCCTCGGAGTTAGCAATCAACACAGCCAGCA
 
. : . : . : . : . : . :
rJMFF030G14- ACATTTCTCTGTATTCTTCTTTTGATTTTGAATCGGATAGTTGCAGTCTTGCA
JMFN035O20+ ACATTTCTCTGTATTCTTCTTTTGATTTTGAATCGGATAGTTGCAGTCTTGCA
JMFN007J06+ ACATTTCTCTGTATTCTTCTTTTGATTTTGAATCGGATAGTTGCAGTCTTGCAGAGAACT
                      ____________________________________________________________
consensus ACATTTCTCTGTATTCTTCTTTTGATTTTGAATCGGATAGTTGCAGTCTTGCAGAGAACT