Previous Contig 002311:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN007D12Sequence566002311 (4)gb:AC130603_17407863e-04Oryza sativa (japonica cultivar-group) chromosome 5 clone B1130G10, complete seq
JMFN013C11Sequence475002311 (4)gb:AC130603_17407862e-04Oryza sativa (japonica cultivar-group) chromosome 5 clone B1130G10, complete seq
JMSF007N04Sequence336002311 (4)gb:AC130603_17407862e-04Oryza sativa (japonica cultivar-group) chromosome 5 clone B1130G10, complete seq502002311 (4)gb:AC130603_17407862e-04Oryza sativa (japonica cultivar-group) chromosome 5 clone B1130G10, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN007D12+ CAATAAGCTTTGAAATTGAGCAATAAT
                      ____________________________________________________________
consensus CAATAAGCTTTGAAATTGAGCAATAAT
 
. : . : . : . : . : . :
JMFN013C11+ GTATATATGTGCTTTAATTGAGGAATAGATCTT
rJMSF007N04- GTATATATGTGCTTTAATTGAGGAATAGATCTT
JMFN007D12+ GAAGCAATTCAATTGACATTGCAGTATGTATATATGTGCTTTAATTGAGGAATAGATCTT
                      ____________________________________________________________
consensus GAAGCAATTCAATTGACATTGCAGTATGTATATATGTGCTTTAATTGAGGAATAGATCTT
 
. : . : . : . : . : . :
JMFN013C11+ GGCCGGAGGTTTTCAAAGTAACGAGACACAAAAACAGACACTACTAATCTTTATTATACT
rJMSF007N04- GGCCGGAGGTTTTCAAAGTAACGAGACACAAAAACAGACACTACTAATCTTTATTATACT
JMFN007D12+ GGCCGGAGGTTTTCAAAGTAA-GAGACACAAAAACAGACACTACTAATCTTTATTATACT
                      ____________________________________________________________
consensus GGCCGGAGGTTTTCAAAGTAACGAGACACAAAAACAGACACTACTAATCTTTATTATACT
 
. : . : . : . : . : . :
JMFN013C11+ TATAAAGCAAACTAATTATGTACATTCAATCGGAGATCCCGGCAAACGTGATGTCTCCGG
rJMSF007N04- TATAAAGCAAACTAATTATGTACATTCAATCGGAGATCCCGGCAAACGTGATGTCTCCGG
JMFN007D12+ TATAAAGCAAACTAATTATGTACATTCAATCGGAGATCCCGGCAAACGTGATGTCTCCGG
                      ____________________________________________________________
consensus TATAAAGCAAACTAATTATGTACATTCAATCGGAGATCCCGGCAAACGTGATGTCTCCGG
 
. : . : . : . : . : . :
JMFN013C11+ GGAAACTCGTCGTCGCGGCGCCCCTCGTCGAAGTTCTGTGAGTAGCTAACGGCGTCGTAC
rJMSF007N04- GGAAACTCGTCGTCGCGGCGCCCCTCGTCGAAGTTCTGTGAGTAGCTAACGGCGTCGTAC
JMSF007N04+ CGTCGCGGCGCCCCTCGTCGAAGTTCTGTGAGTAGCTAACGGCGTCGTAC
JMFN007D12+ GGAAACTCGTCGTCGCGGCGCCCCTCGTCGAAGTTCTGTGAGTAGCTAACGGCGTCGTAC
                      ____________________________________________________________
consensus GGAAACTCGTCGTCGCGGCGCCCCTCGTCGAAGTTCTGTGAGTAGCTAACGGCGTCGTAC
 
. : . : . : . : . : . :
JMFN013C11+ TGGAACGACGTCGTCATCGGCTTGGATCTACACATGATCTTGCCGTCGTTCACCAACTTC
rJMSF007N04- TGGAACGACGTCGTCATCGGCTTGGATCTACACATGATCTTGCCGTCGTTCACCAACTTC
JMSF007N04+ TGGAACGACGTCGTCATCGGCTTGGATCTACACATGATCTTGCCGTCGTTCACCAACTTC
JMFN007D12+ TGGAACGACGTCGTCATCGGCTTGGATCTACACATGATCTTGCCGTCGTTCACCAACTTC
                      ____________________________________________________________
consensus TGGAACGACGTCGTCATCGGCTTGGATCTACACATGATCTTGCCGTCGTTCACCAACTTC
 
. : . : . : . : . : . :
JMFN013C11+ TTTATGATCTTCCCCCACGAGGAGGAGGAGGAGGAGGACGGTCTCCGGTACCGGCCGCCG
rJMSF007N04- TTTATGATCTTCCCCCACGAGGAGGAGGAGGAGGAGGACGGTCTCCGGTACCGGCCGCCG
JMSF007N04+ TTTATGATCTTCCCCCACGAGGAGGAGGAGGAGGAGGACGGTCTCCGGTACCGGCCGCCG
JMFN007D12+ TTTATGATCTTCCCCCACGAGGAGGAGGAGGAGGAGGACGGTCTCCGGTACCGGCCGCCG
                      ____________________________________________________________
consensus TTTATGATCTTCCCCCACGAGGAGGAGGAGGAGGAGGACGGTCTCCGGTACCGGCCGCCG
 
. : . : . : . : . : . :
JMFN013C11+ CCGCCGTCGACGTGGCAGGCGTTTATCCGCGAGTACTCCTCGTGCACGGGGACGCACGAC
rJMSF007N04- CCGCCGTCGACGTGGCAGGCGTTTATCCGCGAGTACTCCTCGTGCACGGGGACGCACGAC
JMSF007N04+ CCGCCGTCGACGTGGCAGGCGTTTATCCGCGAGTACTCCTCGTGCACGGGGACGCACGAC
JMFN007D12+ CCGCCGTCGACGTGGCAGGCGTTTATCCGCGAGTACTCCTCGTGCACGGGGACGCACGAC
                      ____________________________________________________________
consensus CCGCCGTCGACGTGGCAGGCGTTTATCCGCGAGTACTCCTCGTGCACGGGGACGCACGAC
 
. : . : . : . : . : . :
JMFN013C11+ GGCGACATGCAGCTGTAGAAGCCGTGATATTGGCGGCGGCGCGTCGGATCGGGCCCCATA
rJMSF007N04- GGCGACATGCAGCTGTAGAAGCCGTGATATTGGCGGCGGCGCGTCGGATCGGGCCCCATA
JMSF007N04+ GGCGACATGCAGCTGTAGAAGCCGTGATATTGGCGGCGGCGCGTCGGATCGGGCCCCATA
JMFN007D12+ GGCGACATGCAGCTGTAGAAGCCGTGATATTGGCGGCGGCGCGTCGGATCGGGCCCCATA
                      ____________________________________________________________
consensus GGCGACATGCAGCTGTAGAAGCCGTGATATTGGCGGCGGCGCGTCGGATCGGGCCCCATA
 
. : . : . : . : . : . :
JMFN013C11+ TCCATAGTGTAGTGTATACGCG
rJMSF007N04- TCCATAGTGTAGTGTATACGCGCTAAAGTTGTAAAATGTGAGAAG
JMSF007N04+ TCCATAGTGTAGTGTATACGCGCTAAAGTTGTAAAATGTGAGAAG
JMFN007D12+ TCCATAGTGTAGTGTATACGCGCTAAAGTTGTAAAATGTGAGAAGACGAAAAATGGTTTT
                      ____________________________________________________________
consensus TCCATAGTGTAGTGTATACGCGCTAAAGTTGTAAAATGTGAGAAGACGAAAAATGGTTTT