Previous Contig 002310:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN007C07Sequence622002310 (5)pir|B84453|B844533e-43probable snRNP splicing factor [imported] - Arabidopsis thaliana>gb:AC007196_153
JMFN032L15Sequence611002310 (5)pir|B84453|B844533e-43probable snRNP splicing factor [imported] - Arabidopsis thaliana>gb:AC007196_153
JMFS028C10Sequence611002310 (5)pir|B84453|B844533e-43probable snRNP splicing factor [imported] - Arabidopsis thaliana>gb:AC007196_153
JMSF023E22Sequence547002310 (5)pir|B84453|B844532e-43probable snRNP splicing factor [imported] - Arabidopsis thaliana>gb:AC007196_153521002310 (5)pir|B84453|B844536e-32probable snRNP splicing factor [imported] - Arabidopsis thaliana>gb:AC007196_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023E22- TCTTCATACAAGGAGCATCTATATATC
JMFS028C10+ ATACAAGGAGCATCTATATATC
JMFN007C07+ ATACAAGGAGCATCTATATATC
                      ____________________________________________________________
consensus TCTTCATACAAGGAGCATCTATATATC
 
. : . : . : . : . : . :
rJMSF023E22- ATGCCTTGATGAAAGCAGTTGTCTAACGCAAAAGACTACCACACTGGGCGGGATATACAT
JMFS028C10+ ATGCCTTGATGAAAGCAGTTGTCTAACGCAAAAGACTACCACACTGGGCGGGATATACAT
JMFN032L15+ AACGCAAAAGACTACCACACTGGGCGGGATATACAT
JMFN007C07+ ATGCCTTGATGAAAGCAGTTGTCTAACGCAAAAGACTACCACACTGGGCGGGATATACAT
                      ____________________________________________________________
consensus ATGCCTTGATGAAAGCAGTTGTCTAACGCAAAAGACTACCACACTGGGCGGGATATACAT
 
. : . : . : . : . : . :
rJMSF023E22- AAAGGCTATCCTCGCCCATGACAGTGCCTTCGAGATTATCTTAGTTCTTAAGGACACAGA
JMFS028C10+ AAAGGCTATCCTCGCCCATGACAGTGCCTTCGAGATTATCTTAGTTCTTAAGGACACAGA
JMSF023E22+ CCCATGACAGTGCCTTCGAGATTATCTTAGTTCTTAAGGACACAGA
JMFN032L15+ AAAGGCTATCCTCGCCCATGACAGTGCCTTCGAGATTATCTTAGTTCTTAAGGACACAGA
JMFN007C07+ AAAGGCTATCCTCGCCCATGACAGTGCCTTCGAGATTATCTTAGTTCTTAAGGACACAGA
                      ____________________________________________________________
consensus AAAGGCTATCCTCGCCCATGACAGTGCCTTCGAGATTATCTTAGTTCTTAAGGACACAGA
 
. : . : . : . : . : . :
rJMSF023E22- AAAAACACGAAGCACAAACCGNTTTACAAAATATGATGTGACATTCATGGCGGCCCTATG
JMFS028C10+ AAAAACACGAAGCACAAACCGTTTTACAAAATA-GATGTGACATTCATGGCGGCCCTATG
JMSF023E22+ AAAAACACGAAGCACAAACCGTTTTACAAAATA-GATGTGACATTCATGGCGGCCCTATG
JMFN032L15+ AAAAACACGAAGCACAAACCGTTTTACAAAATA-GATGTGACATTCATGGCGGCCCTATG
JMFN007C07+ AAAAACACGAAGCACAAACCGTTTTACAAAATA-GATGTGACATTCATGGCGGCCCTATG
                      ____________________________________________________________
consensus AAAAACACGAAGCACAAACCGTTTTACAAAATA-GATGTGACATTCATGGCGGCCCTATG
 
. : . : . : . : . : . :
rJMSF023E22- CCCCATCGGGCTGGAGGAAAGGATTGGCGATCTCATCTGNGCCGTCAGTTGGCGCCACAA
JMFS028C10+ CCCCATCGGGCTGGAGGAAAGGATTGGCGATCTCATCTGTGCCGTCAGTTGGCGCCACAA
JMSF023E22+ CCCCATCGGGCTGGAGGAAAGGATTGGCGATCTCATCTGTGCCGTCAGTNGGCGCCACAA
JMFN032L15+ CCCCATCGGGCTGGAGGAAAGGATTGGCGATCTCATCTGTGCCGTCAGTTGGCGCCACAA
JMFN007C07+ CCCCATCGGGCTGGAGGAAAGGATTGGCGATCTCATCTGTGCCGTCAGTTGGCGCCACAA
                      ____________________________________________________________
consensus CCCCATCGGGCTGGAGGAAAGGATTGGCGATCTCATCTGTGCCGTCAGTTGGCGCCACAA
 
. : . : . : . : . : . :
rJMSF023E22- GCATAACTGCAGTCCCCCTACACACAATTAATCCNANANNCCGTGTCTGATCTGTTGTCT
JMFS028C10+ GCATAACTGCAGTCCCCCTACACACAATTAATCCAAGACGCCGTGTCTGATCTGTTGTCT
JMSF023E22+ GCATAACTGCAGTCCCCCTACACACAATTAATCCAAGACGCCGTGTCTGATCTGTTGTCT
JMFN032L15+ GCATAACTGCAGTCCCCCTACACACAATTAATCCAAGACGCCGTGTCTGATCTGTTGTCT
JMFN007C07+ GCATAACTGCAGTCCCCCTACACACAATTAATCCAAGACGCCGTGTCTGATCTGTTGTCT
                      ____________________________________________________________
consensus GCATAACTGCAGTCCCCCTACACACAATTAATCCAAGACGCCGTGTCTGATCTGTTGTCT
 
. : . : . : . : . : . :
rJMSF023E22- TCATAGGATCATCACAATCTCTANGATACTCAATGGCTTCATCCAAGACAAGATTCAGCA
JMFS028C10+ TCAGAGGATCATCAGAATCTCTAAGATACTCAATGGCTTCATCCAAGACAAGATTCAGCA
JMSF023E22+ TCAGAGGATCATCAGAATCTCTAAGATACTCAATGGCTTCATCCAAGACAAGATTCAGCA
JMFN032L15+ TCAGAGGATCATCAGAATCTCTAAGATACTCAATGGCTTCATCCAAGACAAGATTCAGCA
JMFN007C07+ TCAGAGGATCATCAGAATCTCTAAGATACTCAATGGCTTCATCCAAGACAAGATTCAGCA
                      ____________________________________________________________
consensus TCAGAGGATCATCAGAATCTCTAAGATACTCAATGGCTTCATCCAAGACAAGATTCAGCA
 
. : . : . : . : . : . :
rJMSF023E22- ATTGGTACATAGCCTTTTAGTGTTCCTACAACTTGTCTGCCACCAGTAAGCTTGACTTGC
JMFS028C10+ ATTGGT-CATAGCCTTTTAGTGTTCCTACAACTTGTCTGCCACCAGTAAGCTTGACTTGC
JMSF023E22+ ATTGGT-CATAGCCTTTTAGTGTTCCTACAACTTGTCTGCCACCAGTAAGCTTGACTTGC
JMFN032L15+ ATTGGT-CATAGCCTTTTAGTGTTCCTACAACTTGTCTGCCACCAGTAAGCTTGACTTGC
JMFN007C07+ ATTGGT-CATAGCCTTTTAGTGTTCCTACAACTTGTCTGCCACCAGTAAGCTTGACTTGC
                      ____________________________________________________________
consensus ATTGGT-CATAGCCTTTTAGTGTTCCTACAACTTGTCTGCCACCAGTAAGCTTGACTTGC
 
. : . : . : . : . : . :
rJMSF023E22- ACACCCTTGNCNACNAACTTTGCCAAATCTAGAACTGTTTCTTTCCTANCTGNACATTCT
JMFS028C10+ ACACCCTTGTCAACGAACTTTGCCAAATCTAGAACTGTTTCTTTCCTACCTG-ACATTCT
JMSF023E22+ ACACCCTTGTCAACGAACTTTGCCAAATCTAGAACTGTTTCTTTCCTACCTG-ACATTCT
JMFN032L15+ ACACCCTTGTCAACGAACTTTGCCAAATCTAGAACTGTTTCTTTCCTACCTG-AC
JMFN007C07+ ACACCCTTGTCAACGAACTTTGCCAAATCTAGAACTGTTTCTTTCCTACCTG-ACATTCT
                      ____________________________________________________________
consensus ACACCCTTGTCAACGAACTTTGCCAAATCTAGAACTGTTTCTTTCCTACCTG-ACATTCT
 
. : . : . : . : . : . :
rJMSF023E22- GATCTTTTANTCGA
JMFS028C10+ GATCTTTTATTCGATCAAACACGAATACGCTGTAATACTCCCCAGTTAAACAGCAAAACA
JMSF023E22+ GATCTTTTATTCGATCAAACACGAATACGCTGTAATACTCCCCAGTTAAACAGCAAAACA
JMFN007C07+ GATCTTTTATTCGATCAAACACGAATACGCTGTAATACTCCCCAGTTAAACAGCAAAACA
                      ____________________________________________________________
consensus GATCTTTTATTCGATCAAACACGAATACGCTGTAATACTCCCCAGTTAAACAGCAAAACA
 
. : . : . : . : . : . :
JMFS028C10+ ACACCCTTTCGGAGCTCAAAAGCTGTGCCCTAACTTCTCTTCCCCTTC
JMSF023E22+ ACACCCTTTCGGAGCTCAAAAGCTGTGCCCTAACTTCTCTTCCCCTTCTCTCTCTCT
JMFN007C07+ ACACCCTTTCGGAGCTCAAAAGCTGTGCCCTAACTTCTCTTCCCCTTCTCTCTCTCTCTC
                      ____________________________________________________________
consensus ACACCCTTTCGGAGCTCAAAAGCTGTGCCCTAACTTCTCTTCCCCTTCTCTCTCTCTCTC