Previous Contig 002308:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039A21Sequence612002308 (11)gb:PTR306825_17027193e-43Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA2 gene).
JMFF040D07Sequence517002308 (11)sp|Q9ZSY8|IAAR_ARATH5e-14Auxin-responsive protein IAA27 (Indoleacetic acid-induced protein 27) (Auxin-ind674002308 (11)gb:PTR306825_17027193e-50Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA2 gene).
JMFF049A10Sequence396002308 (11)sp|Q9ZSY8|IAAR_ARATH1e-13Auxin-responsive protein IAA27 (Indoleacetic acid-induced protein 27) (Auxin-ind
JMFN007A04Sequence448002308 (11)sp|Q9ZSY8|IAAR_ARATH1e-13Auxin-responsive protein IAA27 (Indoleacetic acid-induced protein 27) (Auxin-ind
JMFN009A18Sequence652002308 (11)sp|Q9ZSY8|IAAR_ARATH5e-33Auxin-responsive protein IAA27 (Indoleacetic acid-induced protein 27) (Auxin-ind
JMFN038M22Sequence608002308 (11)sp|Q9ZSY8|IAAR_ARATH2e-23Auxin-responsive protein IAA27 (Indoleacetic acid-induced protein 27) (Auxin-ind
JMSF005P03Sequence275002308 (11)sp|Q9ZSY8|IAAR_ARATH4e-05Auxin-responsive protein IAA27 (Indoleacetic acid-induced protein 27) (Auxin-ind382002308 (11)gb:PTR306825_17027193e-11Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA2 gene).
JMSF023N14Sequence677002308 (11)sp|Q9ZSY8|IAAR_ARATH3e-23Auxin-responsive protein IAA27 (Indoleacetic acid-induced protein 27) (Auxin-ind775002308 (11)gb:PTR306825_17027191e-62Populus tremula x Populus tremuloides mRNA for aux/IAA protein (IAA2 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF005P03- AAGTAAGGCGTAATATCAC
rJMFF039A21- AGAGTTACAGAAGTAAGGCATAATATCAC
rJMFF040D07- ATTGTGCCTTTTTGTGGCAGAACAACAAGGAGAGTTACAGAAGTAAGGCATAATATCAC
rJMSF023N14- ACAAGGAGAGTTACAGAAGTAAGGCATAATATCAC
                      ____________________________________________________________
consensus ATTGTGCCTTTTTGTGGCAGAACAACAAGGAGAGTTACAGAAGTAAGGCATAATATCAC
 
. : . : . : . : . : . :
rJMSF005P03- TGATTTACAATGTATAATACTAATAATAGTAGTGTCCAGTCCACTTACCAAAGAAATAAG
rJMFF039A21- TGATTTACAATGTATAATACTAATAATAGTAGTGTCCAGTCCACTTACCAAAGAAATAAG
rJMFF040D07- TGATTTACAATGTATAATACTAATAATAGTAGTGTCCAGTCCACTTACCAAAGAAATAAG
rJMSF023N14- TGATTTACAATGTATAATACTAATAATAGTAGTGTCCAGTCCACTTACCAAAGAAATAAG
                      ____________________________________________________________
consensus TGATTTACAATGTATAATACTAATAATAGTAGTGTCCAGTCCACTTACCAAAGAAATAAG
 
. : . : . : . : . : . :
rJMSF005P03- AATACAGGAAAATAAACACAGCAATTAAAGCCTATAAAGAGCTTAGAATAATTATGAATA
rJMFF039A21- AATACAGGAAAATAAACACAGCAATTAAAGCCTATAAAGAGCTTAGAATAATTATGAATA
rJMFF040D07- AATACAGGAAAATAAACACAGCAATTAAAGCCTATAAAGAGCTTAGAATAATTATGAATA
rJMSF023N14- AATACAGGAAAATAAACACAGCAATTAAAGCCTATAAAGAGCTTAGAATAATTATGAATA
                      ____________________________________________________________
consensus AATACAGGAAAATAAACACAGCAATTAAAGCCTATAAAGAGCTTAGAATAATTATGAATA
 
. : . : . : . : . : . :
rJMSF005P03- CATCTATTTATTAGTTCACTAGAATTTTGTTTTGGGCACAGACAAAACACCAGGTGGATG
rJMFF039A21- CATCTATTTATTAGTTCACTAGAATTTTGTTTTGGGCACAGACAAAACACCAGGTGGATG
rJMFF040D07- CATCTATTTATTAGTTCACTAGAATTTTGTTTTGGGCACAGACAAAACACCAGGTGGATG
rJMSF023N14- CATCTATTTATTAGTTCACTAGAATTTTGTTTTGGGCACAGACAAAACACCAGGTGGATG
                      ____________________________________________________________
consensus CATCTATTTATTAGTTCACTAGAATTTTGTTTTGGGCACAGACAAAACACCAGGTGGATG
 
. : . : . : . : . : . :
rJMSF005P03- GTTGACTTGATATGCAGATGATCAAGCATCCATTTTATGATCTCAGTTTGCTTGCACTCA
rJMFF039A21- GTTGACTTGATATGCAGATGATCAAGCATCCATTTTATGATCTCAGTTTGCTTGCACTCA
rJMFF040D07- GTTGACTTGATATGCAGATGATCAAGCATCCATTTTATGATCTCAGTTTGCTTGCACTCA
rJMSF023N14- GTTGACTTGATATGCAGATGATCAAGCATCCATTTTATGATCTCAGTTTGCTTGCACTCA
                      ____________________________________________________________
consensus GTTGACTTGATATGCAGATGATCAAGCATCCATTTTATGATCTCAGTTTGCTTGCACTCA
 
. : . : . : . : . : . :
rJMSF005P03- GATCGACCACTTCATCTCTAGCGGTTTTTGCACTTCTCCATGGCTCGAGGAGCTAGGCCG
rJMFF039A21- GATCGACCACTTCATCTCTAGCGGTTTTTGCACTTCTCCATGGCTCGAGGAGCTAGGCCG
rJMFF040D07- GATCGACCACTTCATCTCTAGCGGTTTTTGCACTTCTCCATGGCTCGAGGAGCTAGGCCG
rJMSF023N14- GATCGACCACTTCATCTCTAGCGGTTTTTGCACTTCTCCATGGCTCGAGGAGCTAGGCCG
                      ____________________________________________________________
consensus GATCGACCACTTCATCTCTAGCGGTTTTTGCACTTCTCCATGGCTCGAGGAGCTAGGCCG
 
. : . : . : . : . : . :
rJMSF005P03- ATTGCATCTGAACTTTTTGTGATCCTTAGGCGCTTGCAAGCATCCACGAACATCTCCCAT
rJMFF039A21- ATTGCATCTGAACTTTTTGTGATCCTTAGGCGCTTGCAAGCATCCACGAACATCTCCCAT
rJMFF040D07- ATTGCATCTGAACTTTTTGTGATCCTTAGGCGCTTGCAAGCATCCACGAACATCTCCCAT
rJMSF023N14- ATTGCATCTGAACTTTTTGTGATCCTTAGGCGCTTGCAAGCATCCACGAACATCTCCCAT
                      ____________________________________________________________
consensus ATTGCATCTGAACTTTTTGTGATCCTTAGGCGCTTGCAAGCATCCACGAACATCTCCCAT
 
. : . : . : . : . : . :
rJMSF005P03- GGG
rJMFF039A21- GGGAGATCGCCAACGAGCATCCAATCACCATCCTTGTCTTCGAAGGTAAGAACATATTCT
rJMFF040D07- GGGAGATCGCCAACGAGCATCCAATCACCATCCTTGTCTTCGAAGGTAAGAACATATTCT
rJMSF023N14- GGGAGATCGCCAACGAGCATCCAATCACCATCCTTGTCTTCGAAGGTAAGAACATATTCT
                      ____________________________________________________________
consensus GGGAGATCGCCAACGAGCATCCAATCACCATCCTTGTCTTCGAAGGTAAGAACATATTCT
 
. : . : . : . : . : . :
rJMFF039A21- GAACCATGTAGAATATCCATCAATCTACTTTCGCTCAAACCATCATGGACAGAAATGCCT
rJMFF040D07- GAACCATGTAGAATATCCATCAATCTACTTTCGCTCAAACCATCATGGACAGAAATGCCT
rJMSF023N14- GAACCATGTAGAATATCCATCAATCTACTTTCGCTCAAACCATCATGGACAGAAATGCCT
                      ____________________________________________________________
consensus GAACCATGTAGAATATCCATCAATCTACTTTCGCTCAAACCATCATGGACAGAAATGCCT
 
. : . : . : . : . : . :
rJMFF039A21- TGTGTTTCATATTGACCAATTGTAAAGCAGCTGAACATTTTCTCCAGGGCCACAGACAGA
rJMFF040D07- TGTGTTTCATATTGACCAATTGTAAAGCAGCTGAACATTTTCTCCAGGGCCACAGACAGA
rJMSF023N14- TGTGTTTCATATTGACCAATTGTAAAGCAGCTGAACATTTTCTCCAGGGCCACAGACAGA
JMFN009A18+ GTTTCATATTGACCAATTGTAAAGCAGCTGAACA-TTTCTCCAGGGCCACAGACAGA
                      ____________________________________________________________
consensus TGTGTTTCATATTGACCAATTGTAAAGCAGCTGAACATTTTCTCCAGGGCCACAGACAGA
 
. : . : . : . : . : . :
rJMFF039A21- TCCTTATAGCTGTTATAGTTCTTGAGGNCNACTTTCCTCAAGT
rJMFF040D07- TCCTTATAGCTGTTATAGTTCTTGAGGTCGACTTTCCTCAAGTAAGGGGCGCCATCCATG
rJMSF023N14- TCCTTATAGCTGTTATAGTTCTTGAGGTCGACTTTCCTCAAGTAAGGGGCGCCATCCATG
JMFN009A18+ TCCTTATAGCTGTTATAGTTCTTGAGGTCGACTTTCCTCAAGTAAGGGGCGCCATCCATG
                      ____________________________________________________________
consensus TCCTTATAGCTGTTATAGTTCTTGAGGTCGACTTTCCTCAAGTAAGGGGCGCCATCCATG
 
. : . : . : . : . : . :
rJMFF040D07- CTGACTTTGACATAG
rJMSF023N14- CTGACTTTGACATAGACACAACTTAATCCCAAGTTTCCATTTGAATCTTCCTTGGTCTTG
JMFN009A18+ CTGACTTTGACATAGACACAACTTAATCCCAAGTTTCCATTTGAATCTTCCTTGGTCTTG
JMFN038M22+ GACATAGACACAACTTAATCCCAAGTTTCCATTGGAATCTTCCTTGGTCTTG
                      ____________________________________________________________
consensus CTGACTTTGACATAGACACAACTTAATCCCAAGTTTCCATTTGAATCTTCCTTGGTCTTG
 
. : . : . : . : . : . :
rJMSF023N14- GGAGGATTAGCAGCCATTGAATTCTTCCGATATGATCGAATTGGGGGCCATCCAACCACC
JMFN009A18+ GGAGGATTAGCAGCCATTGAATTCTTCCGATATGATCGAATTGGGGGCCATCCAACCACC
JMSF023N14+ GAGGATTAGCAGCCATTGAATTCTTCCGATATGATCGAATTGGGGGCCATCCAACCACC
JMFN038M22+ GGAGGATTAGCAGCCATTGAATTCTTCCGATATGATCGAATTGGGGGCCATCCAACCACC
                      ____________________________________________________________
consensus GGAGGATTAGCAGCCATTGAATTCTTCCGATATGATCGAATTGGGGGCCATCCAACCACC
 
. : . : . : . : . : . :
rJMSF023N14- TGGGCCTTTGCAGCAGG
JMFN009A18+ TGGGCCTTTGCAGCAGGAGCAACCCCATGGTTAGGTGCAGAAGAAAGCTGAGGCTTTTGG
JMSF023N14+ TGGGCCTTTGCAGCAGGAGCAACCCCATGGTTAGGTGCAGAAGAAAGCTGAGGCTTTTGG
JMFN038M22+ TGGGCCTTTGCAGCAGGAGCAACCCCATGGTTAGGTGCAGAAGAAAGCTGAGGCTTTTGG
                      ____________________________________________________________
consensus TGGGCCTTTGCAGCAGGAGCAACCCCATGGTTAGGTGCAGAAGAAAGCTGAGGCTTTTGG
 
. : . : . : . : . : . :
JMFN009A18+ TCTTGAGTTGGGGTTGGGGATGGCAGAGAAGATTCTTTGGAAGCCACGTCAGACTGGTGG
JMSF023N14+ TCTTGAGTTGGGGTTGGGGATGGCAGAGAAGATTCTTTGGAAGCCACGTCAGACTGGTGG
JMFF040D07+ CCACGTCAGACTGGTGG
JMFF049A10+ TTTGGAAGCCACGTCAGACTGGTGG
JMFN038M22+ TCTTGAGTTGGGGTTGGGGATGGCAGAGAAGATTCTTTGGAAGCCACGTCAGACTGGTGG
                      ____________________________________________________________
consensus TCTTGAGTTGGGGTTGGGGATGGCAGAGAAGATTCTTTGGAAGCCACGTCAGACTGGTGG
 
. : . : . : . : . : . :
JMFN009A18+ GTGGTATTCTCTGCAGGGCAAAGAATCTTGGCAGCACCATTGACACCCCTAGGAGAGAAC
JMSF023N14+ GTGGTATTCTCTGCAGGGCAAAGAATCTTGGCAGCACCATTGACACCCCTAGGAGAGAGC
JMFF040D07+ GTGGTATTCTCTGCAGGGCAAAGAATCTTGGCAGCACCATTGACACCCCTAGGAGAGAAC
JMFF049A10+ GTGGTATTCTCTGCAGGGCAAAGAATCTTGGCAGCACCATTGACACCCCTAGGAGAGAAC
JMFN038M22+ GTGGTATTCTCTGCAGGGCAAAGAATCTTGGCAGCACCATTGACACCCCTAGGAGAGAAC
JMFN007A04+ AGCACCATTGACACCCCTAGGAGAGAAC
                      ____________________________________________________________
consensus GTGGTATTCTCTGCAGGGCAAAGAATCTTGGCAGCACCATTGACACCCCTAGGAGAGAAC
 
. : . : . : . : . : . :
JMFN009A18+ AAGGCAGCACCTTTGGGGATATCAGCCTCAGATCCACCACTCCCAGGGAAAACCCACTTC
JMSF023N14+ AAGGCAGCACCTTTGGGGATATCAGCCTCAGATCCACCACTCCCAGGGAAAACCCACTTC
JMFF040D07+ AAGGCAGCACCTTTGGGGATATCAGCCTCAGATCCACCACTCCCAGGGAAAACCCACTTC
JMFF049A10+ AAGGCAGCACCTTTGGGGATATCAGCCTCAGATCCACCACTCCCAGGGAAAACCCACTTC
JMFN038M22+ AAGGCAGCACCTTTGGGGATATCAGCCTCAGATCCACCACTCCCAGGGAAAACCCACTTC
JMFN007A04+ AAGGCAGCACCTTTGGGGATATCAGCCTCAGATCCACCACTCCCAGGGAAAACCCACTTC
                      ____________________________________________________________
consensus AAGGCAGCACCTTTGGGGATATCAGCCTCAGATCCACCACTCCCAGGGAAAACCCACTTC
 
. : . : . : . : . : . :
JMFN009A18+ CCAGAACCACCATTGATGGTGTCTGAGAAGCCCCTCTTGGCCCTCAAAACACCCACTGGC
JMSF023N14+ CCAGAACCACCATTGATGGTGTCTGAGAAGCCCCTCTTGGCCCTCAAAACACCCACTGGC
JMFF040D07+ CCAGAACCACCATTGATGGTGTCTGAGAAGCCCCTCTTGGCCCTCAAAACACCCACTGGC
JMFF049A10+ CCAGAACCACCATTGATGGTGTCTGAGAAGCCCCTCTTGGCCCTCAAAACACCCACTGGC
JMFN038M22+ CCAGAACCACCATTGATGGTGTCTGAGAAGCCCCTCTTGGCCCTCAAAACACCCACTGGC
JMFN007A04+ CCAGAACCACCATTGATGGTGTCTGAGAAGCCCCTCTTGGCCCTCAAAACACCCACTGGC
                      ____________________________________________________________
consensus CCAGAACCACCATTGATGGTGTCTGAGAAGCCCCTCTTGGCCCTCAAAACACCCACTGGC
 
. : . : . : . : . : . :
JMFN009A18+ CCATTATCCCTCTCTGGGGACTCAGAACCGGGCAACCCCAACCTCAGCTCAGTAGCCTTC
JMSF023N14+ CCATTATCCCTCTCTGGGGACTCAGAACCGGGCAACCCCAACCTCAGCTCAGTAGCCTTC
JMFF040D07+ CCATTATCCCTCTCTGGGGACTCAGAACCGGGCAACCCCAACCTCAGCTCAGTAGCCTTC
JMFF049A10+ CCATTATCCCTCTCTGGGGACTCAGAACCGGGCAACCCCAACCTCAGCTCAGTAGCCTTC
JMFN038M22+ CCATTATCCCTCTCTGGGGACTCAGAACCGGGCAACCCCAACCTCAGCTCAGTAGCCTTC
JMSF005P03+ CAGAACCGGGCAACCCCAACCTCAGCTCAGTAGCCTTC
JMFN007A04+ CCATTATCCCTCTCTGGGGACTCAGAACCGGGCAACCCCAACCTCAGCTCAGTAGCCTTC
                      ____________________________________________________________
consensus CCATTATCCCTCTCTGGGGACTCAGAACCGGGCAACCCCAACCTCAGCTCAGTAGCCTTC
 
. : . : . : . : . : . :
JMFN009A18+ AAGTTCAAATCTTTGCCTTTCCTCTCACTCTCCACTGAGGAAACACAGCTCTTCTC
JMSF023N14+ AAGTTCAAATCTTTGCCTTTCCTCTCACTCTCCACTGAGGAAACACAGCTCTTCTCAGAG
JMFF040D07+ AAGTTCAAATCTTTGCCTTTCCTCTCACTCTCCACTGAGGAAACACAGCTCTTCTCAGAG
JMFF049A10+ AAGTTCAAATCTTTGCCTTTCCTCTCACTCTCCACTGAGGAAACACAGCTCTTCTCAGAG
JMFN038M22+ AAGTTCAAATCTTTGCCTTTCCTCTCACTCTCCACTGAGGAAACACAGCTCTTCTCAGAG
JMSF005P03+ AAGTTCAAATCTTTGCCTTTCCTCTCACTCTCCACTGAGGAAACACAGCTCTTCTCAGAG
JMFN007A04+ AAGTTCAAATCTTTGCCTTTCCTCTCACTCTCCACTGAGGAAACACAGCTCTTCTCAGAG
                      ____________________________________________________________
consensus AAGTTCAAATCTTTGCCTTTCCTCTCACTCTCCACTGAGGAAACACAGCTCTTCTCAGAG
 
. : . : . : . : . : . :
JMSF023N14+ GTCTCCATTGAAGGGGACTCTGATAGGCCTATGTAATCATGCTCCTCTAAGGGTTTCGAC
JMFF040D07+ GTCTCCATTGAAGGGTACTCTGATAGGCCTATGTAATCATGCTCCTCTAAGGGTTTCGAC
JMFF049A10+ GTCTCCATTGAAGGGGACTCTGATAGGCCTATGTAATCATGCTCCTCTAAGGGTTTCGAC
JMFN038M22+ GTCTCCATTGAAGGGGACTCTGATAGGCCTATGTAATCATGCTCCTCTAAGGGTTTCGAC
JMSF005P03+ GTCTCCATTGAAGGGGACTCTGATAGGCCTATGTAATCATGCTCCTCTAAGGGTTTCGAC
JMFN007A04+ GTCTCCATTGAAGGGGACTCTGATAGGCCTATGTAATCATGCTCCTCTAAGGGTTTCGAC
                      ____________________________________________________________
consensus GTCTCCATTGAAGGGGACTCTGATAGGCCTATGTAATCATGCTCCTCTAAGGGTTTCGAC
 
. : . : . : . : . : . :
JMSF023N14+ ATCAA
JMFF040D07+ ATCAA
JMFF049A10+ ATCAAC
JMFN038M22+ ATCAACTCCCAGAACA
JMSF005P03+ ATCAACTCCCAGAACACTATCACTCAGAAATGCAAATATGGAGCAATAGAAGTGAAGTGT
JMFN007A04+ ATCAACTCCCAGAACACTATCACTCAGAAATGCAAATATGGAGCAATAGAAGTGAAGTGT
                      ____________________________________________________________
consensus ATCAACTCCCAGAACACTATCACTCAGAAATGCAAATATGGAGCAATAGAAGTGAAGTGT
 
. : . : . : . : . : . :
JMSF005P03+ GTGTTTTTAGCCAAACAAGAAGTACTATAGCAGAGTGTAAAATTCAAGAATACAGT
JMFN007A04+ GTGTTTTTAGCCAAACAAGAAGTACTATAGCAGAGTGTAAAATTCAAGAATACAGTGAGG
                      ____________________________________________________________
consensus GTGTTTTTAGCCAAACAAGAAGTACTATAGCAGAGTGTAAAATTCAAGAATACAGTGAGG