Previous Contig 002304:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN006M24Sequence540002304 (3)gb:AK176727_18187150.001Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-26-P11.
JMFN008K09Sequence536002304 (3)gb:AK176727_18187150.001Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-26-P11.
JMFN019O12Sequence532002304 (3)gb:AK176727_18187150.001Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-26-P11.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN008K09+ ACTCCAATTTCATGTTATATTATAAAAACTGCATACAATACAGCTCGATGTGATCTCTA
JMFN019O12+ ACTCCAATTTCATGTTATATTATAAAAATTGCATACAATACAGCTCGATGTGATTTCTA
JMFN006M24+ AACTCCAATTTCATGTTATATTATAAAAACTGCATACAATACAGCTCGATGTGATCTCTA
                      ____________________________________________________________
consensus AACTCCAATTTCATGTTATATTATAAAAACTGCATACAATACAGCTCGATGTGATCTCTA
 
. : . : . : . : . : . :
JMFN008K09+ CCGATTACAAAGCATTTTGAACATCTGTGATCATGTCATAGATGATATACATACATGTTA
JMFN019O12+ CCGATTACAAAGCATTTTGAACATCTGTGATCATGTCATAGATGATATACATACATGTTA
JMFN006M24+ CCGATTACAAAGCATTTTGAACATCTGTGATCATGTCATAGATGATATACATACATGTTA
                      ____________________________________________________________
consensus CCGATTACAAAGCATTTTGAACATCTGTGATCATGTCATAGATGATATACATACATGTTA
 
. : . : . : . : . : . :
JMFN008K09+ TCCATTTCCTTCCAGGTTGGGATGTACATTACATTAATCACCCTCTAAAACAGCTAAAGT
JMFN019O12+ TCCATTTCCTTCCAGGTTGGGATGTACATTACATTAATCACCCTCTAAAACAGCTAAAGT
JMFN006M24+ TCCATTTCCTTCCAGGTTGGGATGTACATTACATTAATCACCCTCTAAAACAGCTAAAGT
                      ____________________________________________________________
consensus TCCATTTCCTTCCAGGTTGGGATGTACATTACATTAATCACCCTCTAAAACAGCTAAAGT
 
. : . : . : . : . : . :
JMFN008K09+ AGGAAAGAAACCACTTTTTCCTCTTAAGAGAAGCATCCTCAGAAATGGCGGCAAAAGTAG
JMFN019O12+ AGGAAAGAAACCACTTTTTCCTCTTAAGAGAAGCATCCTCAGAAATGGCGGCAAAAGTAG
JMFN006M24+ AGGAAAGAAACCACTTTTTCCTCTTAAGAGAAGCATCCTCAGAAATGGCGGCAAAAGTAG
                      ____________________________________________________________
consensus AGGAAAGAAACCACTTTTTCCTCTTAAGAGAAGCATCCTCAGAAATGGCGGCAAAAGTAG
 
. : . : . : . : . : . :
JMFN008K09+ TGTTCTGATGATGATGAGGTTGATAATGTTGTTGTTTATAGTGGGGAGGCGGGGCTGAGA
JMFN019O12+ TGTTCTGATGATGATGAGGTTGATAATGTTGTTGTTTATAGTGGGGAGGCGGGGCTGAGA
JMFN006M24+ TGTTCTGATGATGATGAGGTTGATAATGTTGTTGTTTATAGTGGGGAGGCGGGGCTGAGA
                      ____________________________________________________________
consensus TGTTCTGATGATGATGAGGTTGATAATGTTGTTGTTTATAGTGGGGAGGCGGGGCTGAGA
 
. : . : . : . : . : . :
JMFN008K09+ AGGCGGAAATATGAGGGGGAGGGGGAGGGGGTGGGTGAGTGGGTAATTCGCTCTTGTGTT
JMFN019O12+ AGGCGGAAATATGAGGGGGAGGGGGAGGGGGTGGGTGAGTGGGTAATTCGCTCTTGTGTT
JMFN006M24+ AGGCGGAAATATGAGGGGGAGGGGGAGGGGGTGGGTGAGTGGGTAATTCGCTCTTGTGTT
                      ____________________________________________________________
consensus AGGCGGAAATATGAGGGGGAGGGGGAGGGGGTGGGTGAGTGGGTAATTCGCTCTTGTGTT
 
. : . : . : . : . : . :
JMFN008K09+ GCTTCCTGTCCTCTCTGGCTTGCGTAAAAACTAGTGTGTAATTTGTACACTCCTCGCCGC
JMFN019O12+ GCTTCCTGTCCTCTCTGGCTTGCGTAAAAACTAGTGTGTAATTTGTACACTCCTCGCCGC
JMFN006M24+ GCTTCCTGTCCTCTCTGGCTTGCGTAAAAACTAGTGTGTAATTTGTACACTCCTCGCCGC
                      ____________________________________________________________
consensus GCTTCCTGTCCTCTCTGGCTTGCGTAAAAACTAGTGTGTAATTTGTACACTCCTCGCCGC
 
. : . : . : . : . : . :
JMFN008K09+ CTCCTTTCTTCTGATCCCATCCCCCAAATTGTGGCACTGATGACCTCCGAGGCCTCTCCT
JMFN019O12+ CTCCTTTCTTCTGATCCCATCCCCCAAATTGTGGCACTGATGACCTCCGAGGCCTCTCCT
JMFN006M24+ CTCCTTTCTTCTGATCCCATCCCCCAAATTGTGGCACTGATGACCTCCGAGGCCTCTCCT
                      ____________________________________________________________
consensus CTCCTTTCTTCTGATCCCATCCCCCAAATTGTGGCACTGATGACCTCCGAGGCCTCTCCT
 
. : . : . : . : . : . :
JMFN008K09+ CCCTATGGACATCCATGGCGGGGTACGGTGGAGATGGAGGATAGGAGAATGGT
JMFN019O12+ CCCTATGGACATCCATGGCGGGGTACGGTGGAGATGGAGGATAGGAGAATGGT
JMFN006M24+ CCCTATGGACATCCATGGCGGGGTACGGTGGAGATGGAGGATAGGAGAATGGTTAGGGAT
                      ____________________________________________________________
consensus CCCTATGGACATCCATGGCGGGGTACGGTGGAGATGGAGGATAGGAGAATGGTTAGGGAT