Previous Contig 002303:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I12Sequence558002303 (3)gb:AY150376_15849414e-64Arabidopsis thaliana putative formamidase (At4g37560) mRNA, complete cds.625009611 (3)pir|T04712|T047124e-84probable formamidase (EC 3.5.1.49) F19F18.40 - Arabidopsis thaliana>gb:ATCHRIV87
JMFF041H18Sequence657002303 (3)gb:AY150376_15849412e-82Arabidopsis thaliana putative formamidase (At4g37560) mRNA, complete cds.595021611pir|T04712|T047122e-72probable formamidase (EC 3.5.1.49) F19F18.40 - Arabidopsis thaliana>gb:ATCHRIV87
JMFN006M18Sequence617002303 (3)gb:AY150376_15849415e-18Arabidopsis thaliana putative formamidase (At4g37560) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF041H18+ TTCAAGCTCTCTTTCCCTATCATTCCATATCTGAAGCAATTCT
                      ____________________________________________________________
consensus TTCAAGCTCTCTTTCCCTATCATTCCATATCTGAAGCAATTCT
 
. : . : . : . : . : . :
JMFF041H18+ TTTGAAGGTGCTGTTCCTATTATCNCAGGGTGGGTTAAACCAGGAAACCTCACACCTGGA
JMFF003I12+ TGGA
                      ____________________________________________________________
consensus TTTGAAGGTGCTGTTCCTATTATCNCAGGGTGGGTTAAACCAGGAAACCTCACACCTGGA
 
. : . : . : . : . : . :
JMFF041H18+ ATATGAGGTGAGTATGCATATATGCCTTCAAAGTACCAAATAGCTTTGGCCGCACAAGGA
JMFF003I12+ ATATGAGGTGAGTATGCATATATGCCTTCAAAGTACCAAATAGCTTTGGCCGCACAAGGA
                      ____________________________________________________________
consensus ATATGAGGTGAGTATGCATATATGCCTTCAAAGTACCAAATAGCTTTGGCCGCACAAGGA
 
. : . : . : . : . : . :
JMFF041H18+ AAGTGATCAGTTAGAAATCCACCACCGTTCTCTCGGTCAAATATTGCTGTATAACCCCAT
JMFF003I12+ AAGTGATCAGTTAGAAATCCACCACCGTTCTCTCGGTCAAATATTGCTGTATAACCCCAT
                      ____________________________________________________________
consensus AAGTGATCAGTTAGAAATCCACCACCGTTCTCTCGGTCAAATATTGCTGTATAACCCCAT
 
. : . : . : . : . : . :
JMFF041H18+ TCATCCCCAGGGAGAGGCCCCAAATTGCAAATTTCAACAGCAAGAAGGTCACCTGGCTTT
JMFF003I12+ TCATCCCCAGGGAGAGGCCCCAAATTGCAAATTTCAACAGCAAGAAGGTCACCTGGCTTT
                      ____________________________________________________________
consensus TCATCCCCAGGGAGAGGCCCCAAATTGCAAATTTCAACAGCAAGAAGGTCACCTGGCTTT
 
. : . : . : . : . : . :
JMFF041H18+ GCTGGGATTCCATCAGTGTATACAATTCTGATAGGCCCACTGAGATAGTGCACAACAGAT
JMFF003I12+ GCTGGGATTCCATCAGTGTATACAATTCTGATAGGCCCACTGAGATAGTGCACAACAGAT
JMFN006M18+ AACAGAT
                      ____________________________________________________________
consensus GCTGGGATTCCATCAGTGTATACAATTCTGATAGGCCCACTGAGATAGTGCACAACAGAT
 
. : . : . : . : . : . :
JMFF041H18+ TGATCAGCATACTTGATATCCTGAGCCGTGTATTGTGATGTTATTCCCCCACCGCTAAAA
JMFF003I12+ TGATCAGCATACTTGATATCCTGAGCCGTGTATTGTGATGTTATTCCCCCACCGCTAAAA
JMFN006M18+ TGATCAGCATACTTGATATCCTGAGCCGTGTATTGTGATGTTATTCCCCCACCGCTAAAA
                      ____________________________________________________________
consensus TGATCAGCATACTTGATATCCTGAGCCGTGTATTGTGATGTTATTCCCCCACCGCTAAAA
 
. : . : . : . : . : . :
JMFF041H18+ TCCACCATCTCCACCCTGAACAACTCCCCTTCTTTCACCTCTGCAACTGGAGGTATATCC
JMFF003I12+ TCCACCATCTCCACCCTGAACAACTCCCCTTCTTTCACCTCTGCAACTGGAGGTATATCC
JMFN006M18+ TCCACCATCTCCACCCTGAACAACTCCCCTTCTTTCACCTCTGCAACTGGAGGTATATCC
                      ____________________________________________________________
consensus TCCACCATCTCCACCCTGAACAACTCCCCTTCTTTCACCTCTGCAACTGGAGGTATATCC
 
. : . : . : . : . : . :
JMFF041H18+ GGGTGCCACCGGTTGTGCAGTGGCGGGTTTTGCTCCCGTGGCTTCTTCTTCACATCAATA
JMFF003I12+ GGGTGCCACCGGTTGTGCAGTGGCGGGTTTTGCTCCCGTGGCTTCTTCTTCACATCAATA
JMFN006M18+ GGGTGCCACTGGTTGTGCAGTGGCGGGTTTTGCTCCCGTGGCTTCTTCTTCACATCAATA
                      ____________________________________________________________
consensus GGGTGCCACCGGTTGTGCAGTGGCGGGTTTTGCTCCCGTGGCTTCTTCTTCACATCAATA
 
. : . : . : . : . : . :
JMFF041H18+ GGCACAACCAGTCTTGGGCCTTGTAAAGCCATAGCCAACCTCAACCTCTGGTGATTAACT
JMFF003I12+ GGCACAACCAGTCTTGGGCCTTGTAAAGCCATAGCCAACCTCAACCTCTGGTGATTAACT
JMFN006M18+ GGCACAACCAGTCTTGGGCCTTGTAAAGCCATAGCCAACCTCAACCTCTGGTGATTAACT
                      ____________________________________________________________
consensus GGCACAACCAGTCTTGGGCCTTGTAAAGCCATAGCCAACCTCAACCTCTGGTGATTAACT
 
. : . : . : . : . : . :
JMFF041H18+ TAGCTGAAGCTAATAGAACTATACCGACAAAGGAAGAATCCACGGAGAGATTGAAGTGTC
JMFF003I12+ TAGCTGAAGCTAATAGAACTATACCGACAAAGGAAGAATCCACGGAGAGATTGAAGTGTC
JMFN006M18+ TAGCTGAAGCTAATAGAACTATACCGACAAAGGAAGAATCCACGGAGAGATTGAAGTGTC
                      ____________________________________________________________
consensus TAGCTGAAGCTAATAGAACTATACCGACAAAGGAAGAATCCACGGAGAGATTGAAGTGTC
 
. : . : . : . : . : . :
JMFF041H18+ TATGGACTTAGGCC
JMFF003I12+ TATGGACTTAGGCC
JMFN006M18+ TATGGACTTAGGCCAATCCCTTCTCTTCATTTTCAGACATTGATGGGTGCTTGGGGTGGA
                      ____________________________________________________________
consensus TATGGACTTAGGCCAATCCCTTCTCTTCATTTTCAGACATTGATGGGTGCTTGGGGTGGA
 
. : . : . : . : . : . :
JMFN006M18+ AGCCTTTTCCCTCGTAGTGGGACGAATGGGGGCCACCTTTGGGCTATGGGCTTTGGTTCA
                      ____________________________________________________________
consensus AGCCTTTTCCCTCGTAGTGGGACGAATGGGGGCCACCTTTGGGCTATGGGCTTTGGTTCA