Previous Contig 002299:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN004B02Sequence624002299 (8)gb:AF213464_17776980.041Nicotiana tabacum cysteine-rich protein mRNA, complete cds.
JMFN006B17Sequence619002299 (8)gb:AF213464_17776980.040Nicotiana tabacum cysteine-rich protein mRNA, complete cds.
JMFN006K23Sequence627002299 (8)gb:AF213464_17776980.042Nicotiana tabacum cysteine-rich protein mRNA, complete cds.
JMFN013J04Sequence655002299 (8)gb:AF213464_17776980.003Nicotiana tabacum cysteine-rich protein mRNA, complete cds.
JMFN013L04Sequence627002299 (8)gb:AF213464_17776980.003Nicotiana tabacum cysteine-rich protein mRNA, complete cds.
JMFN017E01Sequence619002299 (8)gb:AF213464_17776980.040Nicotiana tabacum cysteine-rich protein mRNA, complete cds.
JMFN032A11Sequence625002299 (8)gb:AF213464_17776980.041Nicotiana tabacum cysteine-rich protein mRNA, complete cds.
JMFS040H12Sequence627002299 (8)gb:AF213464_17776980.042Nicotiana tabacum cysteine-rich protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN013J04+ CAAAAGTGACAT
                      ____________________________________________________________
consensus CAAAAGTGACAT
 
. : . : . : . : . : . :
JMFN013L04+ CCACTATCTCAAAATACGAT
JMFN013J04+ ATAGTCTTACATGATAGGGATGACAAGAAAAATCG-----CCACTATCTCAAAATACGAT
JMFN032A11+ ACAAGAAAAACCGTACCACCACTATCTCAGAATACAAT
JMFN017E01+ AAAACCGTACCACCACTATCTCAGAATACAAT
JMFN004B02+ CCACTATCTCAGAATACAAT
JMFN006B17+ AAAAACCGTACCACCACTATCTCAGAATACAAT
JMFS040H12+ CCACTATCTCAGAATACAAT
JMFN006K23+ ACAAGAAAAACCGTACCACCACTATCTCAGAATACAAT
                      ____________________________________________________________
consensus ATAGTCTTACATGATAGGGATGACAAGAAAAACCGTACCACCACTATCTCAGAATACAAT
 
. : . : . : . : . : . :
JMFN013L04+ CTTGAATTCAAATATAGAAATCCTATGATGTTTCACATTAAATATAATAGATTGCTTTAT
JMFN013J04+ CTTGAATTCAAATATAGAAATCCTATGATGTTTCACATTAAATATAATAGATTGCTTTAT
JMFN032A11+ CTTGACTTCAAATATAGAAATCTTATGATGTTTCACATTAAATATAATAGATTGCTTTAT
JMFN017E01+ CTTGACTTCAAATATAGAAATCTTATGATGTTTCACATTAAATATAATAGATTGCTTTAT
JMFN004B02+ CTTGACTTCAAATATAGAAATCTTATGATGTTTCACATTAAATATAATAGATTGCTTTAT
JMFN006B17+ CTTGACTTCAAATATAGAAATCTTATGATGTTTCACATTAAATATAATAGATTGCTTTAT
JMFS040H12+ CTTGACTTCAAATATAGAAATCTTATGATGTTTCACATTAAATATAATAGATTGCTTTAT
JMFN006K23+ CTTGACTTCAAATATAGAAATCTTATGATGTTTCACATTAAATATAATAGATTGCTTTAT
                      ____________________________________________________________
consensus CTTGACTTCAAATATAGAAATCTTATGATGTTTCACATTAAATATAATAGATTGCTTTAT
 
. : . : . : . : . : . :
JMFN013L04+ TATTCTTCTATATTTTTACCCGTCCTTATTTAAGTTGTTTTTTCCTCGTCCTTAACTAAC
JMFN013J04+ TATTCTTCTATATTTTTACCCGTCCTTATTTAAGTTGTTTTTTCCTCGTCCTTAACTAAC
JMFN032A11+ TATTATT-----------CCCATCCTTAATTAAGTTGTTTTTTCCTCATCCTTAACTAGC
JMFN017E01+ TATTATT-----------CCCATCCTTAATTAAGTTGTTTTTTCCTCATCCTTAACTAGC
JMFN004B02+ TATTATT-----------CCCATCCTTAATTAAGTTG-TTTTTCCTCATCCTTAACTAGC
JMFN006B17+ TATTATT-----------CCCATCCTTAATTAAGTTG-TTTTTCCTCATCCTTAACTAGC
JMFS040H12+ TATTATT-----------CCCATCCTTAATTAAGTTGTTTTTTCCTCATCCTTAACTAGC
JMFN006K23+ TATTATT-----------CCCATCCTTAATTAAGTTGTTTTTTCCTCATCCTTAACTAGC
                      ____________________________________________________________
consensus TATTATT-----------CCCATCCTTAATTAAGTTGTTTTTTCCTCATCCTTAACTAGC
 
. : . : . : . : . : . :
JMFN013L04+ TTATTGTCATCCTTAAGAAGCTTGTCCTCATCCTTAAGTTGTTTGTTCTCATCCTTAAGG
JMFN013J04+ TTATTGTCATCCTTAAGAAGCTTGTCCTCATCCTTAAGTTGTTTGTTCTCATCCTTAAGG
JMFN032A11+ TTATTGTCGTCCTTAAGAAGCTTGTCCTCATCCTTAAGCTGCTTGTTCTCTTCCTTAAAG
JMFN017E01+ TTATTGTCGTCCTTAAGAAGCTTGTCCTCATCCTTAAGCTGCTTGTTCTCTTCCTTAAAG
JMFN004B02+ TTATTGTCGTCCTTAAGAAGCTTGTCCTCATCCTTAAGCTGCTTGTTCTCTTCCTTAAAG
JMFN006B17+ TTATTGTCGTCCTTAAGAAGCTTGTCCTCATCCTTAAGCTGCTTGTTCTCTTCCTTAAAG
JMFS040H12+ TTATTGTCGTCCTTAAGAAGCTTGTCCTCATCCTTAAGCTGCTTGTTCTCTTCCTTAAAG
JMFN006K23+ TTATTGTCGTCCTTAAGAAGCTTGTCCTCATCCTTAAGCTGCTTGTTCTCTTCCTTAAAG
                      ____________________________________________________________
consensus TTATTGTCGTCCTTAAGAAGCTTGTCCTCATCCTTAAGCTGCTTGTTCTCTTCCTTAAAG
 
. : . : . : . : . : . :
JMFN013L04+ AGCTTATGCATGTCTTTACAGAACTCTTCCTCGTCCTTACATTGGTTGTCGCCGTCCTTA
JMFN013J04+ AGCTTATGCATGTCTTTACAGAACTCTTCCTCGTCCTTACATTGGTTGTCGCCGTCCTTA
JMFN032A11+ GCCATATGCATGTCCTTACAGAACTTCGCCTCGTCCTTACATTCCTTGTCGTCGTCCTTA
JMFN017E01+ GCCATATGCATGTCCTTACAGAACTTCGCCTCGTCCTTACATTCCTTGTCGTCGTCCTTA
JMFN004B02+ GCCATATGCATGTCCTTACAGAACTTCGCCTCGTCCTTACATTCCTTGTCGTCGTCCTTA
JMFN006B17+ GCCATATGCATGTCCTTACAGAACTTCGCCTCGTCCTTACATTCCTTGTCGTCGTCCTTA
JMFS040H12+ GCCATATGCATGTCCTTACAGAACTTCGCCTCGTCCTTACATTCCTTGTCGTCGTCCTTA
JMFN006K23+ GCCATATGCATGTCCTTACAGAACTTCGCCTCGTCCTTACATTCCTTGTCGTCGTCCTTA
                      ____________________________________________________________
consensus GCCATATGCATGTCCTTACAGAACTTCGCCTCGTCCTTACATTCCTTGTCGTCGTCCTTA
 
. : . : . : . : . : . :
JMFN013L04+ CATTGCTTATTCTTAAAGTCCTTACAATGCATGCCCACAAACTCCACAACTTGTTTTTTC
JMFN013J04+ CATTGCTTATTCTTAAAGTCCTTACAATGCATGCCCACAAACTCCACAACTTGTTTTTTC
JMFN032A11+ CATTGCTTATTCTCAAAGTCCTTGCAACGCATGTCCATATACTCCTTAACTTGTTTTTTC
JMFN017E01+ CATTGCTTATTCTCAAAGTCCTTGCAACGCATGTCCATATACTCCTTAACTTGTTTTTTC
JMFN004B02+ CATTGCTTATTCTCAAAGTCCTTGCAACGCATGTCCATATACTCCTTAACTTGTTTTTTC
JMFN006B17+ CATTGCTTATTCTCAAAGTCCTTGCAACGCATGTCCATATACTCCTTAACTTGTTTTTTC
JMFS040H12+ CATTGCTTATTCTCAAAGTCCTTGCAACGCATGTCCATATACTCCTTAACTTGTTTTTTC
JMFN006K23+ CATTGCTTATTCTCAAAGTCCTTGCAACGCATGTCCATATACTCCTTAACTTGTTTTTTC
                      ____________________________________________________________
consensus CATTGCTTATTCTCAAAGTCCTTGCAACGCATGTCCATATACTCCTTAACTTGTTTTTTC
 
. : . : . : . : . : . :
JMFN013L04+ TTAAAGGCCCAAAGTTCCTTCTCCTCGTCCGTAAGTTGCGTGCCCTCGTCCTTAACCTTG
JMFN013J04+ TTAAAGGCCCAAAGTTCCTTCTCCTCGTCCGTAAGTTGCGTGCCCTCGTCCTTAACCTTG
JMFN032A11+ TGAAAGGCCCAAAGTTCCTTCTCCTCTTCCTTAAGTTCCTTGCTCTCGTCCTTAAGCTTG
JMFN017E01+ TGAAAGGCCCAAAGTTCCTTCTCCTCTTCCTTAAGTTCCTTGCTCTCGTCCTTAAGCTTG
JMFN004B02+ TGAAAGGCCCAAAGTTCCTTCTCCTCTTCCTTAAGTTCCTTGCTCTCGTCCTTAAGCTTG
JMFN006B17+ TGAAGGGCCCAAAGTTCCTTCTCCTCTTCCTTAAGTTCCTTGCTCTCGTCCTTAAGCTTG
JMFS040H12+ TGAAAGGCCCAAAGTTCCTTCTCCTCTTCCTTAAGTTCCTTGCTCTCGTCCTTAAGCTTG
JMFN006K23+ TGAAAGGCCCAAAGTTCCTTCTCCTCTTCCTTAAGTTCCTTGCTCTCGTCCTTAAGCTTG
                      ____________________________________________________________
consensus TGAAAGGCCCAAAGTTCCTTCTCCTCTTCCTTAAGTTCCTTGCTCTCGTCCTTAAGCTTG
 
. : . : . : . : . : . :
JMFN013L04+ CCCTCTTTATACGCCTTGTCGGTACATTCGATTTCACATTCTCTGTTGCATACAAGTACG
JMFN013J04+ CCCTCTTTATACGCCTTGTCGGTACATTCGATTTCACATTCTCTGTTGCATACAAGTACG
JMFN032A11+ CCCTCTTTATACGCCTTGTCTGTACATCCCCTTTCACATTCTTTTCCGCATGCAAAGACG
JMFN017E01+ CCCTCTTTATACGCCTTGTCTGTACATCCCCTTTCACATTCTTTTCCGCATGCAAAGACG
JMFN004B02+ CCCTCTTTATACGCCTTGTCTGTACATCCCCTTTCACATTCTTTTCCGCATGCAAAGACG
JMFN006B17+ CCCTCTTTATACGCCTTGTCTGTACATCCCCTTTCACATTCTTTTCCGCATGCAAAGACG
JMFS040H12+ CCCTCTTTATACGCCTTGTCTGTACATCCCCTTTCACATTCTTTTCCGCATGCAAAGACG
JMFN006K23+ CCCTCTTTATACGCCTTGTCTGTACATCCCCTTTCACATTCTTTTCCGCATGCAAAGACG
                      ____________________________________________________________
consensus CCCTCTTTATACGCCTTGTCTGTACATCCCCTTTCACATTCTTTTCCGCATGCAAAGACG
 
. : . : . : . : . : . :
JMFN013L04+ GTTTTTCCTTTGTCTTTGCAAGCGGAATGGCATGGATCGAAGCATGACCTGTAAACCGAA
JMFN013J04+ GTTTTTCCTTTGTCTTTGCAAGCGGAATGGCATGGATCGAAGCATGACCTGTAAACCGAA
JMFN032A11+ GTTTTTCCTGTGTCTTTGCAAGCAGAATGGCATGGATCGAAGCATGACTGGTAAACCGAA
JMFN017E01+ GTTTTTCCTGTGTCTTTGCAAGCAGAATGGCATGGATCGAAGCATGACTGGTAAACCGAA
JMFN004B02+ GTTTTTCCTGTGTCTTTGCAAGCAGAATGGCATGGATCGAAGCATGACTGGTAAACCGAA
JMFN006B17+ GTTTTTCCTGTGTCTTTGCAAGCAGAATGGCATGGATCGAAGCATGACTGGTAAACCGAA
JMFS040H12+ GTTTTTCCTGTGTCTTTGCAAGCAGAATGGCATGGATCGAAGCATGACTGGTAAACCGAA
JMFN006K23+ GTTTTTCCTGTGTCTTTGCAAGCAGAATGGCATGGATCGAAGCATGACTGGTAAACCGAA
                      ____________________________________________________________
consensus GTTTTTCCTGTGTCTTTGCAAGCAGAATGGCATGGATCGAAGCATGACTGGTAAACCGAA
 
. : . : . : . : . : . :
JMFN013L04+ GAAAGCGAAGCGTCGACAGTGAGGACAAACATGCACACCAGACACACTGCAACGTTAACC
JMFN013J04+ GAAAGCGAAGCGTCGACAGTGAGGACAAACATGCACACCAGACACACTGCAACGTTAACC
JMFN032A11+ GAAAGCGAAGCGTCGACGGTGAGGACAAACATGCACACCAGACACACTGCAACGTTAACC
JMFN017E01+ GAAAGCGAAGCGTCGACGGTGAGGACAAACATGCACACCAGACACACTGCAACGTTAACC
JMFN004B02+ GAAAGCGAAGCGTCGACGGTGAGGACAAACATGCACACCAGACACACTGCAACGTTAACC
JMFN006B17+ GAAAGCGAAGCGTCGACGGTGAGGACAAACATGCACACCAGACACACTGCAACGTTAACC
JMFS040H12+ GAAAGCGAAGCGTCGACGGTGAGGACAAACATGCACACCAGACACACTGCAACGTTAACC
JMFN006K23+ GAAAGCGAAGCGTCGACGGTGAGGACAAACATGCACACCAGACACACTGCAACGTTAACC
                      ____________________________________________________________
consensus GAAAGCGAAGCGTCGACGGTGAGGACAAACATGCACACCAGACACACTGCAACGTTAACC
 
. : . : . : . : . : . :
JMFN013L04+ AACTTCTGGGCAGCCGACATTGTTTATTGTTTGTTG-TTTTATTATTGA
JMFN013J04+ AACTTCTGGGCAGCCGACATTGTTTATTGTTTGTTG-TTTTATTATTGA
JMFN032A11+ AACTTCTGGGCAGCCGACATTGTTTATTGTTTGTTGTTTTTGTTATTGATGTAGTGTT
JMFN017E01+ AACTTCTGGGCAGCCGACATTGTTTATTGTTTGTTGTTTTTGTTATTGATGTAGTGTT
JMFN004B02+ AACTTCTGGGCAGCCGACATTGTTTATTGTTTGTTGTTTTTGTTATTGAT
JMFN006B17+ AACTTCTGGGCAGCCGACATTGTTTATTGTTTGTTGTTTTTGTTATTGATGTAGTGTT
JMFS040H12+ AACTTCTGGGCAGCCGACATTGTTTATTGTTTGTTGTTTTTGTT
JMFN006K23+ AACTTCTGGGCAGCCGACATTGTTTATTGTTTGTTGTTTTTGTTATTGATGTAGTGTTTC
                      ____________________________________________________________
consensus AACTTCTGGGCAGCCGACATTGTTTATTGTTTGTTGTTTTTGTTATTGATGTAGTGTTTC