Previous Contig 002286:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046F03Sequence435002286 (4)gb:AF145386_17720123e-16Phaseolus vulgaris hypersensitive reaction associated Ca2+-binding protein (HRA3
JMFN005N01Sequence593002286 (4)gb:AF145386_17720124e-39Phaseolus vulgaris hypersensitive reaction associated Ca2+-binding protein (HRA3
JMFN032C19Sequence634002286 (4)gb:AF145386_17720127e-42Phaseolus vulgaris hypersensitive reaction associated Ca2+-binding protein (HRA3
JMFS152E10Sequence619002286 (4)gb:AF145386_17720127e-42Phaseolus vulgaris hypersensitive reaction associated Ca2+-binding protein (HRA3

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046F03- ACCCTCGAGAGTTTTTTTTTTTTTTGAAAGGAAAACTGTGATGTTTA
                      ____________________________________________________________
consensus ACCCTCGAGAGTTTTTTTTTTTTTTGAAAGGAAAACTGTGATGTTTA
 
. : . : . : . : . : . :
rJMFF046F03- ATTGATTTGATTATGGAATCTACAGAGTTGAATAAAAGACAAGAAAATAGCAGCTGTCAT
                      ____________________________________________________________
consensus ATTGATTTGATTATGGAATCTACAGAGTTGAATAAAAGACAAGAAAATAGCAGCTGTCAT
 
. : . : . : . : . : . :
rJMFF046F03- ACAGCTCAGCACATGATANNNNACAAGGAAAGTTGAGGAATTGCATTGCTGCACGGCTAC
JMFS152E10+ AGGAATTGCATTGCTGCACGGCTAC
JMFN032C19+ CACGGCTAC
                      ____________________________________________________________
consensus ACAGCTCAGCACATGATANNNNACAAGGAAAGTTGAGGAATTGCATTGCTGCACGGCTAC
 
. : . : . : . : . : . :
rJMFF046F03- CTAAAAAACAAAAAGGACAGAAAAAGTTGTAGGGGGGTATCCATC-CCCATCCCCATCCC
JMFS152E10+ CTAAAAAACAAAAAGGACAGAAANAGTTGTAGGGGGGTATCCATC-CCCATCCCCATCCC
JMFN032C19+ CTAAAAAACAAAAAGGACAGAAAAAG-TGTAGGGGGGTATCCATCNCCCATCCCCATCCC
                      ____________________________________________________________
consensus CTAAAAAACAAAAAGGACAGAAAAAGTTGTAGGGGGGTATCCATC-CCCATCCCCATCCC
 
. : . : . : . : . : . :
rJMFF046F03- CTCAGGCCTCAGGCCTCCTCATCAGATCAGATTAGATACACAAAATCTTGCATAAACCCT
JMFS152E10+ CTCAGGCCTCAGGCCTCCTCATCAGATCAGATTAGATACACAAAATCTTGCATAAACCCT
JMFN032C19+ CTCAGGCCTCAGGCCTCCTCATCAGATCAGATTAGATACACAAAATCTTGCATAAACCCT
                      ____________________________________________________________
consensus CTCAGGCCTCAGGCCTCCTCATCAGATCAGATTAGATACACAAAATCTTGCATAAACCCT
 
. : . : . : . : . : . :
rJMFF046F03- CTAAGGTGACGCCTCCACCATTTTCATCACCACCGCCCAATTTGATCATGGCATTCACAT
JMFS152E10+ CTAAGGTGACGCCTCCACCATTTTCATCACCACCGCCCAATTTGATCATGGCATTCACAT
JMFN032C19+ CTAAGGTGACGCCTCCACCATTTTCATCACCACCGCCCAATTTGATCATGGCATTCACAT
JMFN005N01+ GACGCCTCCACCATTTTCATCACCACCGCCCAATTTGATCATGGCATTCACAT
                      ____________________________________________________________
consensus CTAAGGTGACGCCTCCACCATTTTCATCACCACCGCCCAATTTGATCATGGCATTCACAT
 
. : . : . : . : . : . :
rJMFF046F03- CTTCATCGTTGGCTTGAAGACCTGCCCAACTCAGATAAGTCTTAAGGTCTTGGTGCCCAA
JMFS152E10+ CTTCATCGTTGGCTTGAAGACCTGCCCAACTCAGATAAGTCTTAAGGTCTTGGTGCCCAA
JMFN032C19+ CTTCATCGTTGGCTTGAAGACCTGCCCAACTCAGATAAGTCTTAAGGTCTTGGTGCCCAA
JMFN005N01+ CTTCATCGTTGGCTTGAAGACCTGCCCAACTCAGATAAGTCTTAAGGTCTTGGTGCCCAA
                      ____________________________________________________________
consensus CTTCATCGTTGGCTTGAAGACCTGCCCAACTCAGATAAGTCTTAAGGTCTTGGTGCCCAA
 
. : . : . : . : . : . :
rJMFF046F03- CCTTGCCATCTCCATCTTTATCCATCACC
JMFS152E10+ CCTTGCCATCTCCATCTTTATCCATCACCCTAAACACATCCTCCATCACGCTCACCCTCC
JMFN032C19+ CCTTGCCATCTCCATCTTTATCCATCACCCTAAACACATCCTCCATCACGCTCACCCTCC
JMFN005N01+ CCTTGCCATCTCCATCTTTATCCATCACCCTAAACACATCCTCCATCACGCTCACCCTCC
                      ____________________________________________________________
consensus CCTTGCCATCTCCATCTTTATCCATCACCCTAAACACATCCTCCATCACGCTCACCCTCC
 
. : . : . : . : . : . :
JMFS152E10+ TAGACCCCACAACCTTCTCGAACTCCTCGTATTCCACGAAACCGTCCTTGTTTGAATCCG
JMFN032C19+ TAGACCCCACAACCTTCTCGAACTCCTCGTATTCCACGAAACCGTCCTTGTTTGAATCCG
JMFN005N01+ TAGACCCCACAACCTTCTCGAACTCCTCGTATTCCACGAAACCGTCCTTGTTTGAATCCG
                      ____________________________________________________________
consensus TAGACCCCACAACCTTCTCGAACTCCTCGTATTCCACGAAACCGTCCTTGTTTGAATCCG
 
. : . : . : . : . : . :
JMFS152E10+ CCACAGAGATCATACTTCCTATCAACTCATCATCTTCCGCTCCCATCGAAAAGTCGTTTT
JMFN032C19+ CCACAGAGATCATACTTCCTATCAACTCATCATCTTCCGCTCCCATCGAAAAGTCGTTTT
JMFN005N01+ CCACAGAGATCATACTTCCTATCAACTCATCATCTTCCGCTCCCATCGAAAAGTCGTTTT
                      ____________________________________________________________
consensus CCACAGAGATCATACTTCCTATCAACTCATCATCTTCCGCTCCCATCGAAAAGTCGTTTT
 
. : . : . : . : . : . :
JMFS152E10+ TGTAGAACGTCCGGAGGTCGTCGGGGCTGATCTTACCGTCGCGGTCCACATCCAGCACCT
JMFN032C19+ TGTAGAACGTCCGGAGGTCGTCGGGGCTGATCTTACCGTCGCGGTCCACATCCAGCACCT
JMFN005N01+ TGTAGAACGTCCGGAGGTCGTCGGGGCTGATCTTACCGTCGCGGTCCACATCCAGCACCT
                      ____________________________________________________________
consensus TGTAGAACGTCCGGAGGTCGTCGGGGCTGATCTTACCGTCGCGGTCCACATCCAGCACCT
 
. : . : . : . : . : . :
JMFS152E10+ CGAACGCTGACCGCAAAGTGCTGGACCGTCTTGCGCTTTCACCGTGTACGCCGCTCTCCG
JMFN032C19+ CGAACGCTGACCGCAAAGTGCTGGACCGTCTTGCGCTTTCACCGTGTACGCCGCTCTCCG
JMFN005N01+ CGAACGCTGACCGCAAAGTGCTGGACCGTCTTGCGCTTTCACCGTGTACGCCGCTCTCCG
                      ____________________________________________________________
consensus CGAACGCTGACCGCAAAGTGCTGGACCGTCTTGCGCTTTCACCGTGTACGCCGCTCTCCG
 
. : . : . : . : . : . :
JMFS152E10+ TTCTCGTCGGACACATCTTTTTCTTTTCCTCACCAAATTCCAA
JMFN032C19+ TTCTCGTCGGACACATCTTTTTCTTTTCCTCACCAAATTCCAACCACAAATAATAA
JMFN005N01+ TTCTCGTCGGACACATCTTTTTCTTTTCCTCACCAAATTCCAACCACAAATAATAATATA
                      ____________________________________________________________
consensus TTCTCGTCGGACACATCTTTTTCTTTTCCTCACCAAATTCCAACCACAAATAATAATATA
 
. : . : . : . : . : . :
JMFN005N01+ ATCAAATAAAGGGGAATGAATTGAAGCGAAGCTTTATAAGATTTGAGAGGGCGCTCTTTC
                      ____________________________________________________________
consensus ATCAAATAAAGGGGAATGAATTGAAGCGAAGCTTTATAAGATTTGAGAGGGCGCTCTTTC
 
. : . : . : . : . : . :
JMFN005N01+ GCTAGGGAGGTATATATAGGCGGACTCCCATATTTTGGGCTCCTCCAGAAGTCGAAGTCT
                      ____________________________________________________________
consensus GCTAGGGAGGTATATATAGGCGGACTCCCATATTTTGGGCTCCTCCAGAAGTCGAAGTCT