Previous Contig 002278:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN005B06Sequence630002278 (7)pir|T47845|T478451e-45hypothetical protein T2O9.190 - Arabidopsis thaliana>gb:ATT2O9_1555771 Arabidops
JMFN012E21Sequence623002278 (7)pir|T47845|T478451e-45hypothetical protein T2O9.190 - Arabidopsis thaliana>gb:ATT2O9_1555771 Arabidops
JMFN019P07Sequence616002278 (7)pir|T47845|T478451e-45hypothetical protein T2O9.190 - Arabidopsis thaliana>gb:ATT2O9_1555771 Arabidops
JMFN031F21Sequence563002278 (7)gb:AE016959_10238829e-37Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08
JMFN033H13Sequence639002278 (7)pir|T47845|T478451e-45hypothetical protein T2O9.190 - Arabidopsis thaliana>gb:ATT2O9_1555771 Arabidops
JMFN042B02Sequence595002278 (7)pir|T47845|T478451e-45hypothetical protein T2O9.190 - Arabidopsis thaliana>gb:ATT2O9_1555771 Arabidops
JMFN043E01Sequence552002278 (7)pir|T47845|T478451e-45hypothetical protein T2O9.190 - Arabidopsis thaliana>gb:ATT2O9_1555771 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN031F21+ CTA
                      ____________________________________________________________
consensus CTA
 
. : . : . : . : . : . :
JMFN031F21+ GTCTCGATTTTTTTTTTTTTTTTAAGCCAAAATACTATGTATATTGNCCAAACAGAGAAT
                      ____________________________________________________________
consensus GTCTCGATTTTTTTTTTTTTTTTAAGCCAAAATACTATGTATATTGNCCAAACAGAGAAT
 
. : . : . : . : . : . :
JMFN031F21+ GAAAATAAACATATTTCAGTATTCAAAATCTAGTCTTGATG-TTCAATGACATGACAAAG
JMFN033H13+ TTCAGTATTCAAAATCTAGTC-TGATGTTTCAATGACATGACAAAG
JMFN019P07+ TGATG-TTCAATGACATGACANAG
JMFN012E21+ TTCAATGACATGACAAAG
JMFN042B02+ AAAG
JMFN005B06+ TGATG-TTCAATGACATGACAAAG
                      ____________________________________________________________
consensus GAAAATAAACATATTTCAGTATTCAAAATCTAGTCTTGATG-TTCAATGACATGACAAAG
 
. : . : . : . : . : . :
JMFN031F21+ CTAGAATACATGAAGCAATGTGCCGTCATCTCCTGAGTTAAACCGGAGGCAGCGATCCTG
JMFN033H13+ CTAGAATACATGAAGCAATGTGCCGTCATCTCCTGAGTTAAACCGGAGGCAGCGATCCTG
JMFN019P07+ CTAGAATACATGAAGCAATGTGCCGTCATCTCCTGAGTTAAACCGGAGGCAGCGATCCTG
JMFN012E21+ CTAGAATACATGAAGCAATGTGCCGTCATCTCCTGAGTTAAACCGGAGGCAGCGATCCTG
JMFN042B02+ CTAGAATACATGAAGCAATGTGCCGTCATCTCCTGAGTTAAACCGGAGGCAGCGATCCTG
JMFN043E01+ AAACCGGAGGCAGCGATCCTG
JMFN005B06+ CTAGAATACATGAAGCAATGTGCCGTCATCTCCTGAGTTAAACCGGAGGCAGCGATCCTG
                      ____________________________________________________________
consensus CTAGAATACATGAAGCAATGTGCCGTCATCTCCTGAGTTAAACCGGAGGCAGCGATCCTG
 
. : . : . : . : . : . :
JMFN031F21+ CACAAGTACAACTCGAAACACTAACGACGCGAAAAATAGCATGTCTGCATTGCCTTTGTA
JMFN033H13+ CACAAGTACAACTCGAAACACTAACGACGCGAAAAATAGCATGTCTGCATTGCCTTTGTA
JMFN019P07+ CACAAGTACAACTCGAAACACTAACGACGCGAAAAATAGCATGTCTGCATTGCCTTTGTA
JMFN012E21+ CACAAGTACAACTCGAAACACTAACGACGCGAAAAATAGCATGTCTGCATTGCCTTTGTA
JMFN042B02+ CACAAGTACAACTCGAAACACTAACGACGCGAAAAATAGCATGTCTGCATTGCCTTTGTA
JMFN043E01+ CACAAGTACAACTCGAAACACTAACGACGCGAAAAATAGCATGTCTGCATTGCCTTTGTA
JMFN005B06+ CACAAGTACAACTCGAAACACTAACGACGCGAAAAATAGCATGTCTGCATTGCCTTTGTA
                      ____________________________________________________________
consensus CACAAGTACAACTCGAAACACTAACGACGCGAAAAATAGCATGTCTGCATTGCCTTTGTA
 
. : . : . : . : . : . :
JMFN031F21+ AGTGCGCAATCTATTCGACCACGGCCAACAAGTCACCCTCTTTACAGAAAACATGCCTTT
JMFN033H13+ AGTGCGCAATCTATTCGACCACGGCCAACAAGTCACCCTCTTTACAGAAAACATGCCTTT
JMFN019P07+ AGTGCGCAATCTATTCGACCACGGCCAACAAGTCACCCTCTTTACAGAAAACATGCCTTT
JMFN012E21+ AGTGCGCAATCTATTCGACCACGGCCAACAAGTCACCCTCTTTACAGAAAACATGCCTTT
JMFN042B02+ AGTGCGCAATCTATTCGACCACGGCCAACAAGTCACCCTCTTTACAGAAAACATGCCTTT
JMFN043E01+ AGTGCGCAATCTATTCGACCACGGCCAACAAGTCACCCTCTTTACAGAAAACATGCCTTT
JMFN005B06+ AGTGCGCAATCTATTCGACCACGGCCAACAAGTCACCCTCTTTACAGAAAACATGCCTTT
                      ____________________________________________________________
consensus AGTGCGCAATCTATTCGACCACGGCCAACAAGTCACCCTCTTTACAGAAAACATGCCTTT
 
. : . : . : . : . : . :
JMFN031F21+ CCTCAGTTCCCAAGTTCACCTCATAAGCATTCACGTCAGAGAAAAGAACCTTCTTCCCAG
JMFN033H13+ CCTCAGTTCCCAAGTTCACCTCATAAGCATTCACGTCAGAGAAAAGAACCTTCTTCCCAG
JMFN019P07+ CCTCAGTTCCCAAGTTCACCTCATAAGCATTCACGTCAGAGAAAAGAACCTTCTTCCCAG
JMFN012E21+ CCTCAGTTCCCAAGTTCACCTCATAAGCATTCACGTCAGAGAAAAGAACCTTCTTCCCAG
JMFN042B02+ CCTCAGTTCCCAAGTTCACCTCATAAGCATTCACGTCAGAGAAAAGAACCTTCTTCCCAG
JMFN043E01+ CCTCAGTTCCCAAGTTCACCTCATAAGCATTCACGTCAGAGAAAAGAACCTTCTTCCCAG
JMFN005B06+ CCTCAGTTCCCAAGTTCACCTCATAAGCATTCACGTCAGAGAAAAGAACCTTCTTCCCAG
                      ____________________________________________________________
consensus CCTCAGTTCCCAAGTTCACCTCATAAGCATTCACGTCAGAGAAAAGAACCTTCTTCCCAG
 
. : . : . : . : . : . :
JMFN031F21+ TCTCCACTTCAGAAACCCCGGTTCCGACAGAGAGAATCTCTCCCATAAGATACCGTTCAA
JMFN033H13+ TCTCCACTTCAGAAACCCCGGTTCCGACAGAGAGAATCTCTCCCATAAGATACCGTTCAA
JMFN019P07+ TCTCCACTTCAGAAACCCCGGTTCCGACAGAGAGAATCTCTCCCATAAGATACCGTTCAA
JMFN012E21+ TCTCCACTTCAGAAACCCCGGTTCCGACAGAGAGAATCTCTCCCATAAGATACCGTTCAA
JMFN042B02+ TCTCCACTTCAGAAACCCCGGTTCCGACAGAGAGAATCTCTCCCATAAGATACCGTTCAA
JMFN043E01+ TCTCCACTTCAGAAACCCCGGTTCCGACAGAGAGAATCTCTCCCATAAGATACCGTTCAA
JMFN005B06+ TCTCCACTTCAGAAACCCCGGTTCCGACAGAGAGAATCTCTCCCATAAGATACCGTTCAA
                      ____________________________________________________________
consensus TCTCCACTTCAGAAACCCCGGTTCCGACAGAGAGAATCTCTCCCATAAGATACCGTTCAA
 
. : . : . : . : . : . :
JMFN031F21+ ACTTCACCGCAGATTTAGGGAGCAAAATGCCTCCAGCAGATTTCTCAGGCAACTCCTCTA
JMFN033H13+ ACTTCACCGCAGATTTAGGGAGCAAAATGCCTCCAGCAGATTTCTCAGGCAACTCCTCTA
JMFN019P07+ ACTTCACCGCAGATTTAGGGAGCAAAATGCCTCCAGCAGATTTCTCAGGCAACTCCTCTA
JMFN012E21+ ACTTCACCGCAGATTTAGGGAGCAAAATGCCTCCAGCAGATTTCTCAGGCAACTCCTCTA
JMFN042B02+ ACTTCACCGCAGATTTAGGGAGCAAAATGCCTCCAGCAGATTTCTCAGGCAACTCCTCTA
JMFN043E01+ ACTTCACCGCAGATTTAGGGAGCAAAATGCCTCCAGCAGATTTCTCAGGCAACTCCTCTA
JMFN005B06+ ACTTCACCGCAGATTTAGGGAGCAAAATGCCTCCAGCAGATTTCTCAGGCAACTCCTCTA
                      ____________________________________________________________
consensus ACTTCACCGCAGATTTAGGGAGCAAAATGCCTCCAGCAGATTTCTCAGGCAACTCCTCTA
 
. : . : . : . : . : . :
JMFN031F21+ ACCTTATCAAGACTCTATCAGCTTGTGGCACAACCTTTGTGGGTTCCCA-TTTTGGGAAA
JMFN033H13+ ACCTTATCAAGACTCTATCAGCTTGTGGCACAACCTTTGTGGGTTCCCATTTTTGGGAAA
JMFN019P07+ ACCTTATCAAGACTCTATCAGCTTGTGGCACAACCTTTGTGGGTTCCCATTTTTGGGAAA
JMFN012E21+ ACCTTATCAAGACTCTATCAGCTTGTGGCACAACCTTTGTGGGTTCCCATTTTTGGGAAA
JMFN042B02+ ACCTTATCAAGACTCTATCAGCTTGTGGCACAACCTTTGTGGGTTCCCATTTTTGGGAAA
JMFN043E01+ ACCTTATCAAGACTCTATCAGCTTGTGGCACAACCTTTGTGGGTTCCCATTTTTGGGAAA
JMFN005B06+ ACCTTATCAAGACTCTATCAGCTTGTGGCACAACCTTTGTGGGTTCCCATTTTTGGGAAA
                      ____________________________________________________________
consensus ACCTTATCAAGACTCTATCAGCTTGTGGCACAACCTTTGTGGGTTCCCATTTTTGGGAAA
 
. : . : . : . : . : . :
JMFN031F21+ GGGCATTAACTCTCAGAGAATT
JMFN033H13+ GGGCATTAACTCTCAGAGAATTTCTCCTCAGACCTATTCCAACGGGTCTGGGGGCGGGGG
JMFN019P07+ GGGCATTAACTCTCAGAGAATTTCTCCTCAGACCTATTCCAACGGGTCTGGGGGCGGGGG
JMFN012E21+ GGGCATTAACTCTCAGAGAATTTCTCCTCAGACCTATTCCAACGGGTCTGGGGGCGGGGG
JMFN042B02+ GGGCATTAACTCTCAGAGAATTTCTCCTCAGACCTATTCCAACGGGTCTGGGGGCGGGGG
JMFN043E01+ GGGCATTAACTCTCAGAGAATTTCTCCTCAGACCTATTCCAACGGGTCTGGGGGCGGGGG
JMFN005B06+ GGGCATTAACTCTCAGAGAATTTCTCCTCAGACCTATTCCAACGGGTCTGGGGGCGGGGG
                      ____________________________________________________________
consensus GGGCATTAACTCTCAGAGAATTTCTCCTCAGACCTATTCCAACGGGTCTGGGGGCGGGGG
 
. : . : . : . : . : . :
JMFN033H13+ ATAGAGAAGGGATGTTAATTGGTTGAGAAGTAAAGGGTTTTGCTAAGGAAAGAAATCCAG
JMFN019P07+ ATAGAGAAGGGATGTTAATTGGTTGAGAAGTAAAGGGTTTTGCTAAGGAAAGAAATCCAG
JMFN012E21+ ATAGAGAAGGGATGTTAATTGGTTGAGAAGTAAAGGGTTTTGCTAAGGAAAGAAATCCAG
JMFN042B02+ ATAGAGAAGGGATGTTAATTGGTTGAGAAGTAAAGGGTTTTGCTAAGGAAAGAAATCCAG
JMFN043E01+ ATAGAGAAGGGATGTTAATTGGTTGAGAAGTAAAGGGTTTTGCTAAGGAAAGAAATCCAG
JMFN005B06+ ATAGAGAAGGGATGTTAATTGGTTGAGAAGTAAAGGGTTTTGCTAAGGAAAGAAATCCAG
                      ____________________________________________________________
consensus ATAGAGAAGGGATGTTAATTGGTTGAGAAGTAAAGGGTTTTGCTAAGGAAAGAAATCCAG
 
. : . : . : . : . : . :
JMFN033H13+ ACGCCATGGATAAGGAAGGTGCAGAGAGATGAAACTATTGCAGGGAGAGTT
JMFN019P07+ ACGCCATGGATAAGGAAGGTGCAGAGAGATGAAACTATTGCAGGGAGAGTT
JMFN012E21+ ACGCCATGGATAAGGAAGGTGCAGAGAGATGAAACTATTGCAGGGAGAGTT
JMFN042B02+ ACGCCATGGATAAGGAAGGTGCAGAGAGATGAAACTATTGCAGGGAGAGTT
JMFN043E01+ ACGCCATGGATAAGGAAGGTGCAGAGAGATGAAACTATTGCAGGGAGAGTT
JMFN005B06+ ACGCCATGGATAAGGAAGGTGCAGAGAGATGAAACTATTGCAGGGAGAGTTGGGAAGTTG
                      ____________________________________________________________
consensus ACGCCATGGATAAGGAAGGTGCAGAGAGATGAAACTATTGCAGGGAGAGTTGGGAAGTTG