Previous Contig 002271:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN004N14Sequence619002271 (4)pir|T00930|T009302e-48hypothetical protein At2g42210 [imported] - Arabidopsis thaliana>gb:AC002561_153
JMFN005B21Sequence578002271 (4)pir|T00930|T009302e-36hypothetical protein At2g42210 [imported] - Arabidopsis thaliana>gb:AC002561_153
JMFN017F20Sequence608002271 (4)pir|T00930|T009302e-48hypothetical protein At2g42210 [imported] - Arabidopsis thaliana>gb:AC002561_153
JMFN038L16Sequence616002271 (4)pir|T00930|T009302e-48hypothetical protein At2g42210 [imported] - Arabidopsis thaliana>gb:AC002561_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN005B21+ GAAAGGAACAACT
                      ____________________________________________________________
consensus GAAAGGAACAACT
 
. : . : . : . : . : . :
JMFN005B21+ TTGTTGAATTATCTTCTTGAATCTTTCAGAAAATGCCTCAACAATAACACCTGTGAGGTT
                      ____________________________________________________________
consensus TTGTTGAATTATCTTCTTGAATCTTTCAGAAAATGCCTCAACAATAACACCTGTGAGGTT
 
. : . : . : . : . : . :
JMFN005B21+ TTCCGAGTTACTCCTATGGAGAACAAGTTTTGAAAAATGACTGCGCAGTATTTATTTTGA
                      ____________________________________________________________
consensus TTCCGAGTTACTCCTATGGAGAACAAGTTTTGAAAAATGACTGCGCAGTATTTATTTTGA
 
. : . : . : . : . : . :
JMFN005B21+ CTAGGAATATCAAACTGAAAACACGGTTCACAGTACACTTTCCAGCTTCCAAAAAGAACA
JMFN017F20+ TCCAAAAAGACNA
JMFN038L16+ TCCAAAAAGAACA
                      ____________________________________________________________
consensus CTAGGAATATCAAACTGAAAACACGGTTCACAGTACACTTTCCAGCTTCCAAAAAGAACA
 
. : . : . : . : . : . :
JMFN005B21+ CACAGCAAGTCTATAAAATAACGCCGCAAGCTCCCATTTTTGTCCAAAGGGAGAACACTT
JMFN017F20+ CACAGCAAGTCTATAAAATAACGCCGCAAGCTCCCATTTTTGTCCAAAGGGAGAACACTT
JMFN038L16+ CACAGCAAGTCTATAAAATAACGCCGCAAGCTCCCATTTTTGTCCAAAGGGAGAACACTT
JMFN004N14+ GTCCAAAGGGAGAACACTT
                      ____________________________________________________________
consensus CACAGCAAGTCTATAAAATAACGCCGCAAGCTCCCATTTTTGTCCAAAGGGAGAACACTT
 
. : . : . : . : . : . :
JMFN005B21+ ACTCAGCATGGGATTTTTTCTTGGTTGTGTATGGATAGTACTCCTTTCCATTGTCGACCC
JMFN017F20+ ACTCAGCATGGGATTTTTTCTTGGTTGTGTATGGATAGTACTCCTTTCCATTGTCGACCC
JMFN038L16+ ACTCAGCATGGGATTTTTTCTTGGTTGTGTATGGATAGTACTCCTTTCCATTGTCGACCC
JMFN004N14+ ACTCAGCATGGGATTTTTTCTTGGTTGTGTATGGATAGTACTCCTTTCCATTGTCGACCC
                      ____________________________________________________________
consensus ACTCAGCATGGGATTTTTTCTTGGTTGTGTATGGATAGTACTCCTTTCCATTGTCGACCC
 
. : . : . : . : . : . :
JMFN005B21+ TCACGGTCTGACCTCCAGCGTCGATTATAGCTGAGGTAACTGCAAGTGCCGCTCCAGCAG
JMFN017F20+ TCACGGTCTGACCTCCAGCGTCGATTATAGCTGAGGTAACTGCAAGTGCCGCTCCAGCAG
JMFN038L16+ TCACGGTCTGACCTCCAGCGTCGATTATAGCTGAGGTAACTGCAAGTGCCGCTCCAGCAG
JMFN004N14+ TCACGGTCTGACCTCCAGCGTCGATTATAGCTGAGGTAACTGCAAGTGCCGCTCCAGCAG
                      ____________________________________________________________
consensus TCACGGTCTGACCTCCAGCGTCGATTATAGCTGAGGTAACTGCAAGTGCCGCTCCAGCAG
 
. : . : . : . : . : . :
JMFN005B21+ AGATAGCAGTTGAAATGCTCTTACCTTTATAACCAAGCACAGAAGCACCGGCTGCAAATC
JMFN017F20+ AGATAGCAGTTGAAATGCTCTTACCTTTATAACCAAGCACAGAAGCACCGGCTGCAAATC
JMFN038L16+ AGATAGCAGTTGAAATGCTCTTACCTTTATAACCAAGCACAGAAGCACCGGCTGCAAATC
JMFN004N14+ AGATAGCAGTTGAAATGCTCTTACCTTTATAACCAAGCACAGAAGCACCGGCTGCAAATC
                      ____________________________________________________________
consensus AGATAGCAGTTGAAATGCTCTTACCTTTATAACCAAGCACAGAAGCACCGGCTGCAAATC
 
. : . : . : . : . : . :
JMFN005B21+ CACCAACAGCACCATTAATAAAGTCCCTTTTCATACGATAATTCTGCATCAGCTGCTCTA
JMFN017F20+ CACCAACAGCACCATTAATAAAGTCCCTTTTCATACGATAATTCTGCATCAGCTGCTCTA
JMFN038L16+ CACCAACAGCACCATTAATAAAGTCCCTTTTCATACGATAATTCTGCATCAGCTGCTCTA
JMFN004N14+ CACCAACAGCACCATTAATAAAGTCCCTTTTCATACGATAATTCTGCATCAGCTGCTCTA
                      ____________________________________________________________
consensus CACCAACAGCACCATTAATAAAGTCCCTTTTCATACGATAATTCTGCATCAGCTGCTCTA
 
. : . : . : . : . : . :
JMFN005B21+ CACCAATATACACTCCACCAATGGCAGCAAATGTCATCCCATAATTACCCATCATCTTCA
JMFN017F20+ CACCAATATACACTCCACCAATGGCAGCAAATGTCATCCCATAATTACCCATCATCTTCA
JMFN038L16+ CACCAATATACACTCCACCAATGGCAGCAAATGTCATCCCATAATTACCCATCATCTTCA
JMFN004N14+ CACCAATATACACTCCACCAATGGCAGCAAATGTCATCCCATAATTACCCATCATCTTCA
                      ____________________________________________________________
consensus CACCAATATACACTCCACCAATGGCAGCAAATGTCATCCCATAATTACCCATCATCTTCA
 
. : . : . : . : . : . :
JMFN005B21+ GTGCTCGAACCAAGCCAGGAAGTGC
JMFN017F20+ GTGCTCGAACCAAGCCAGGAAGTGCAACACTTCTCTCAACACGAGGCACATCATACCAAG
JMFN038L16+ GTGCTCGAACCAAGCCAGGAAGTGCAACACTTCTCTCAACACGAGGCACATCATACCAAG
JMFN004N14+ GTGCTCGAACCAAGCCAGGAAGTGCAACACTTCTCTCAACACGAGGCACATCATACCAAG
                      ____________________________________________________________
consensus GTGCTCGAACCAAGCCAGGAAGTGCAACACTTCTCTCAACACGAGGCACATCATACCAAG
 
. : . : . : . : . : . :
JMFN017F20+ TAGCAACAATAGTACCCCAAAGAGCACCAGCAGCTAGACCTGTGGTTGCACCTTTTATTG
JMFN038L16+ TAGCAACAATAGTACCCCAAAGAGCACCAGCAGCTAGACCTGTGGTTGCACCTTTTATTG
JMFN004N14+ TAGCAACAATAGTACCCCAAAGAGCACCAGCAGCTAGACCTGTGGTTGCACCTTTTATTG
                      ____________________________________________________________
consensus TAGCAACAATAGTACCCCAAAGAGCACCAGCAGCTAGACCTGTGGTTGCACCTTTTATTG
 
. : . : . : . : . : . :
JMFN017F20+ TTTTCATCATTGGAGTATCATCATCCTCGTAGTATCTGAGCTCTGAGGAGTCCATAGCTT
JMFN038L16+ TTTTCATCATTGGAGTATCATCATCCTCGTAGTATCTGAGCTCTGAGGAGTCCATAGCTT
JMFN004N14+ TTTTCATCATTGGAGTATCATCATCCTCGTAGTATCTGAGCTCTGAGGAGTCCATAGCTT
                      ____________________________________________________________
consensus TTTTCATCATTGGAGTATCATCATCCTCGTAGTATCTGAGCTCTGAGGAGTCCATAGCTT
 
. : . : . : . : . : . :
JMFN017F20+ AACAAGAAACCACAATAACTGTACCGGGTGGGATTGAAGGAGTGGTAACTGATAC
JMFN038L16+ AACAAGAAACCACAATAACTGTACCGGGTGGGATTGAAGGAGTGGTAACTGATACTGATC
JMFN004N14+ AACAAGAAACCACAATAACTGTACCGGGTGGGATTGAAGGAGTGGTAACTGATACTGATC
                      ____________________________________________________________
consensus AACAAGAAACCACAATAACTGTACCGGGTGGGATTGAAGGAGTGGTAACTGATACTGATC
 
. : . : . : . : . : . :
JMFN038L16+ TGT
JMFN004N14+ TGTGTTGCCGGAGAGAGAGAGAGAGAGAGAGAGAGATTGGAATTTGGAAGCTCAGGAAGG
                      ____________________________________________________________
consensus TGTGTTGCCGGAGAGAGAGAGAGAGAGAGAGAGAGATTGGAATTTGGAAGCTCAGGAAGG