Previous Contig 002269:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN004M12Sequence498002269 (4)gb:AY085971_15710329e-21Arabidopsis thaliana clone 2031 mRNA, complete sequence.
JMFN042A17Sequence649002269 (4)gb:AY085971_15710322e-26Arabidopsis thaliana clone 2031 mRNA, complete sequence.
JMSF016J01Sequence448002269 (4)gb:AY085971_15710328e-27Arabidopsis thaliana clone 2031 mRNA, complete sequence.713001108 (18)sp|Q9LF30|R192_ARATH3e-6640S ribosomal protein S19-2.>pir|T51530|T51530 40S RIBOSOMAL PROTEIN S19-like -
JMSF034E16Sequence772019793674002269 (4)gb:AY085971_15710325e-23Arabidopsis thaliana clone 2031 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034E16- CAAAA
                      ____________________________________________________________
consensus CAAAA
 
. : . : . : . : . : . :
rJMSF034E16- TGACTTTTTATCTTTCAATTGCCTTTCCTAGTCTGCAATCCAAATATCATCATTAGGGTT
JMFN042A17+ TGCAATCCAAATATCATCATTAGGGTT
                      ____________________________________________________________
consensus TGACTTTTTATCTTTCAATTGCCTTTCCTAGTCTGCAATCCAAATATCATCATTAGGGTT
 
. : . : . : . : . : . :
rJMSF034E16- TCTATTCTCCTCTTCATCTGTAGCATCCAGAAGCCATTCATGGACTCCAAAAAGAAAGAA
JMFN042A17+ TCTATTCTCCTCTTCATCTGTAGCATCCAGAAGCCATTCATGGACTCCAAAAAGAAAGAA
                      ____________________________________________________________
consensus TCTATTCTCCTCTTCATCTGTAGCATCCAGAAGCCATTCATGGACTCCAAAAAGAAAGAA
 
. : . : . : . : . : . :
rJMSF034E16- AAGAATTTATTAAGCTGCAGAACAAAACTGTTTCCAATTTGAAACCAGGAGAGCAAAAAG
JMFN042A17+ AAGAATTTATTAAGCTGCAGAACAAAACTGTTTCCAATTTGAAACCAGGAGAGCAAAAAG
                      ____________________________________________________________
consensus AAGAATTTATTAAGCTGCAGAACAAAACTGTTTCCAATTTGAAACCAGGAGAGCAAAAAG
 
. : . : . : . : . : . :
rJMSF034E16- GTGTTTTGCTAGCTAAGCAAATACCAGATGGGTTTTAACTTTTAAGTAATTAAGACAATG
JMFN042A17+ GTGTTTTGCTAGCTAAGCAAATACCAGATGGGTTTTAACTTTTAAGTAATTAAGACAATG
                      ____________________________________________________________
consensus GTGTTTTGCTAGCTAAGCAAATACCAGATGGGTTTTAACTTTTAAGTAATTAAGACAATG
 
. : . : . : . : . : . :
rJMSF034E16- GGTTTATGAGCATGGTCTGCGAGGCAAGCCAAATAGTGAATCTCTGTTATTTCAAACACG
JMFN042A17+ GGTTTATGAGCATGGTCTGCGAGGCAAGCCAAATAGTGAATCTCTGTTATTTCAAACACG
JMSF016J01+ TTTATGAGCATGGTCTGCGAGNCAAGCCAAATAGTGAATCTCTGTTATTTCAAACACG
                      ____________________________________________________________
consensus GGTTTATGAGCATGGTCTGCGAGGCAAGCCAAATAGTGAATCTCTGTTATTTCAAACACG
 
. : . : . : . : . : . :
rJMSF034E16- GATGAACACGAGATGGTCTATGCAGAAGCGGTCTTCTTTTGCTGGAACATGACGGCCCAA
JMFN042A17+ GATGAACACGAGATGGTCTATGCAGAAGCGGTCTTCTTTTGCTGGAACATGACGGCCCAA
JMSF016J01+ GATGAACACGAGATGGTCTATGCAGAAGCGGTCTTCTTTTGCTGGAACATGACGGCCCAA
JMFN004M12+ GAAGCGGTCTTCTTTTGCTGGAACATGACGGCCCAA
                      ____________________________________________________________
consensus GATGAACACGAGATGGTCTATGCAGAAGCGGTCTTCTTTTGCTGGAACATGACGGCCCAA
 
. : . : . : . : . : . :
rJMSF034E16- ACGGGGACTCCAACACCAATGCTGAATGCAGTAAATACGCCAAGACTCATCTTCAGCTTC
JMFN042A17+ ACGGGGACTCCAACACCAATGCTGAATGCAGTAAATACGCCAAGACTCATCTTCAGCTTC
JMSF016J01+ ACGGGGACTCCAACACCAATGCTGAATGCAGTAAATACGCCAAGACTCATCTTCAGCTTC
JMFN004M12+ ACGGGGACTCCAACACCAATGCTGAATGCAGTAAATACGCCAAGACTCATCTTCAGCTTC
                      ____________________________________________________________
consensus ACGGGGACTCCAACACCAATGCTGAATGCAGTAAATACGCCAAGACTCATCTTCAGCTTC
 
. : . : . : . : . : . :
rJMSF034E16- TGGTTTTTCATCCTATCCAAGTTGTACATGTGCTTTGCGTGAATGTAGAATGGCTC
JMFN042A17+ TGGTTTTTCATCCTATCCAAGTTGTACATGTGCTTTGCGTGAATGTAGAATGGCTC
JMSF016J01+ TGGTTTTTCATCCTATCCAAGTTGTACATGTGCTTTGCGTGAATGTAGAATGGCTC
JMFN004M12+ TGGTTTTT--TCCTATCCAAGTTGTACATGTGCTTTGCGTGAATGTAGAATGGCTCATCG
                      ____________________________________________________________
consensus TGGTTTTTCATCCTATCCAAGTTGTACATGTGCTTTGCGTGAATGTAGAATGGCTCATCG
 
. : . : . : . : . : . :
JMFN004M12+ TGGCCATGACCTCCCATTCTTTTCACACCTGTTGAGTGGATTCCTCTGTTCAGAGTCTTG
                      ____________________________________________________________
consensus TGGCCATGACCTCCCATTCTTTTCACACCTGTTGAGTGGATTCCTCTGTTCAGAGTCTTG
 
. : . : . : . : . : . :
JMFN004M12+ GGGAGAAATGAATCGGCTGCCGTTATGAGCTTGGAGGCGCACGATCTCAACCCGTTGTTC
                      ____________________________________________________________
consensus GGGAGAAATGAATCGGCTGCCGTTATGAGCTTGGAGGCGCACGATCTCAACCCGTTGTTC