Previous Contig 002268:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN004L12Sequence375002268 (3)
JMSF049O15Sequence375002268 (3)322002268 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049O15+ TTTTTTTTTTAACAAAGTAAACAGA
JMFN004L12+ AACAAAGTAAACAGA
                      ____________________________________________________________
consensus TTTTTTTTTTAACAAAGTAAACAGA
 
. : . : . : . : . : . :
JMSF049O15+ TCAGAATTGTATTAATCAGATCATTACACATATATTTATGGCATATGCAAAGTTCACTAC
rJMSF049O15- CATATATTTATGGCATATGCAAAGTTCACTAC
JMFN004L12+ TCAGAATTGTATTAATCAGATCATTACACATATATTTATGGCATATGCAAAGTTCACTAC
                      ____________________________________________________________
consensus TCAGAATTGTATTAATCAGATCATTACACATATATTTATGGCATATGCAAAGTTCACTAC
 
. : . : . : . : . : . :
JMSF049O15+ CATTGTCACTTGAACAAGTGATCCAAGGTGGTGAAGCTTCCCAATTGCCATGCAATTTAT
rJMSF049O15- CATTGTCACTTGAACAAGTGATCCAAGGTGGTGAAGCTTCCCAATTGCCATGCAATTTAT
JMFN004L12+ CATTGTCACTTGAACAAGTGATCCAAGGTGGTGAAGCTTCCCAATTGCCATGCAATTTAT
                      ____________________________________________________________
consensus CATTGTCACTTGAACAAGTGATCCAAGGTGGTGAAGCTTCCCAATTGCCATGCAATTTAT
 
. : . : . : . : . : . :
JMSF049O15+ TCATTAACTAATTAAATCTGCATGCATGCATGCAGCCATCCGTACGAAACACATACTATA
rJMSF049O15- TCATTAACTAATTAAATCTGCATGCATGCATGCAGCCATCCGTACGAAACACATACTATA
JMFN004L12+ TCATTAACTAATTAAATCTGCATGCATGCATGCAGCCATCCGTACGAAACACATACTATA
                      ____________________________________________________________
consensus TCATTAACTAATTAAATCTGCATGCATGCATGCAGCCATCCGTACGAAACACATACTATA
 
. : . : . : . : . : . :
JMSF049O15+ CGTGTAATTCAAGAAAAAATATAAGCTGCTTAATTCCATCTTCATCATATCGCTACTTTG
rJMSF049O15- CGTGTAATTCAAGAAAAAATATAAGCTGCTTAATTCCATCTTCATCATATCGCTACTTTG
JMFN004L12+ CGTGTAATTCAAGAAAAAATATAAGCTGCTTAATTCCATCTTCATCATATCGCTACTTTG
                      ____________________________________________________________
consensus CGTGTAATTCAAGAAAAAATATAAGCTGCTTAATTCCATCTTCATCATATCGCTACTTTG
 
. : . : . : . : . : . :
JMSF049O15+ TATGTAGTTTAATTAGTTTTAATCGCCACCGTTTCCGCCGCCGTATCCTGAGCCATAGCC
rJMSF049O15- TATGTAGTTTAATTAGTTTTAATCGCCACCGTTTCCGCCGCCGTATCCTGAGCCATAGCC
JMFN004L12+ TATGTAGTTTAATTAGTTTTAATCGCCACCGTTTCCGCCGCCGTATCCTGAGCCATAGCC
                      ____________________________________________________________
consensus TATGTAGTTTAATTAGTTTTAATCGCCACCGTTTCCGCCGCCGTATCCTGAGCCATAGCC
 
. : . : . : . : . : . :
JMSF049O15+ CGACCCATACCCAGACCCACTCCCATATCCGGAACCGTTGCCGCCACCGC
rJMSF049O15- CGACCCATACCCAGACCCACTCCCATATCCGGAACCGTTGCCGCCACCGC
JMFN004L12+ CGACCCATACCCAGACCCACTCCCATATCCGGAACCGTTGCCGCCACCGCCGCCGCCATC
                      ____________________________________________________________
consensus CGACCCATACCCAGACCCACTCCCATATCCGGAACCGTTGCCGCCACCGCCGCCGCCATC