Previous Contig 002264:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012G19Sequence498002264 (7)524002264 (7)
JMFF031P10Sequence561002264 (7)522002264 (7)
JMFN004H10Sequence636002264 (7)
JMFN019P19Sequence576002264 (7)
JMFN032N20Sequence444002264 (7)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF012G19- GAGATACTAAT
rJMFF031P10- TACTAAT
JMFN032N20+ TTATTAACCGTAAAATCTTTATTGGAGATACTAAT
JMFF031P10+ TTTTTTTTTTGTTATTAACCGTAAAATCTTTATTGGAGATACTAAT
JMFN019P19+ TTATTAACCGTAAAATCTTTATTGGAGATACTAAT
JMFN004H10+ TTATTAACCGTAAAATCTTTATTGGAGATACTAAT
                      ____________________________________________________________
consensus TTTTTTTTTTGTTATTAACCGTAAAATCTTTATTGGAGATACTAAT
 
. : . : . : . : . : . :
rJMFF012G19- ATACAAACATTTGAGAACAAATATACATAAGTTCAACCACATATTGTGATTTACTTTCCC
rJMFF031P10- ATACAAACATTTGAGAACAAATATACATAAGTTCAACCACATATTGTGATTTACTTTCCC
JMFF012G19+ AACAAATATACATAAGTTCAACCACATATTGTGATTTACTTTCCC
JMFN032N20+ ATACAAACATTTGAGAACAAATATACATAAGTTCAACCACATATTGTGATTTACTTTCCC
JMFF031P10+ ATACAAACATTTGAGAACAAATATACATAAGTTCAACCACATATTGTGATTTACTTTCCC
JMFN019P19+ ATACAAACATTTGAGAACAAATATACATAAGTTCAACCACATATTGTGATTTACTTTCCC
JMFN004H10+ ATACAAACATTTGAGAACAAATATACATAAGTTCAACCACATATTGTGATTTACTTTCCC
                      ____________________________________________________________
consensus ATACAAACATTTGAGAACAAATATACATAAGTTCAACCACATATTGTGATTTACTTTCCC
 
. : . : . : . : . : . :
rJMFF012G19- CTCTACCTGATTTAGGTAGCTAGTAGCCAGTGGTGATGGACTGATGGCCTCACACTTATT
rJMFF031P10- CTCTACCTGATTTAGGTAGCTAGTAGCCAGTGGTGATGGACTGATGGCCTCACACTTATT
JMFF012G19+ CTCTACCTGATTTAGGTAGCTAGTAGCCAGTGGTGATGGACTGATGGCCTCACACTTATT
JMFN032N20+ CTCTACCTGATTTAGGTAGCTAGTAGCCAGTGGTGATGGACTGATGGCCTCACACTTATT
JMFF031P10+ CTCTACCTGATTTAGGTAGCTAGTAGCCAGTGGTGATGGACTGATGGCCTCACACTTATT
JMFN019P19+ CTCTACCTGATTTAGGTAGCTAGTAGCCAGTGGTGATGGACTGATGGCCTCACACTTATT
JMFN004H10+ CTCTACCTGATTTAGGTAGCTAGTAGCCAGTGGTGATGGACTGATGGCCTCACACTTATT
                      ____________________________________________________________
consensus CTCTACCTGATTTAGGTAGCTAGTAGCCAGTGGTGATGGACTGATGGCCTCACACTTATT
 
. : . : . : . : . : . :
rJMFF012G19- TTTTTTTAAAACAGGATCGGTTACGAAAGTTCTTACACACATTTAAGTTAGGGTTCACTG
rJMFF031P10- TTTTTTTAAAACAGGATCGGTTACGAAAGTTCTTACACACATTTAAGTTAGGGTTCACTG
JMFF012G19+ TTTTTTTAAAACAGGATCGGTTACGAAAGTTCTTACACACATTTAAGTTAGGGTTCACTG
JMFN032N20+ TTTTTTTAAAACAGGATCGGTTACGAAAGTTCTTACACACATTTAAGTTAGGGTTCACTG
JMFF031P10+ TTTTTTTAAAACAGGATCGGTTACGAAAGTTCTTACACACATTTAAGTTAGGGTTCACTG
JMFN019P19+ TTTTTTTAAAACAGGATCGGTTACGAAAGTTCTTACACACATTTAAGTTAGGGTTCACTG
JMFN004H10+ TTTTTTTAAAACAGGATCGGTTACGAAAGTTCTTACACACATTTAAGTTAGGGTTCACTG
                      ____________________________________________________________
consensus TTTTTTTAAAACAGGATCGGTTACGAAAGTTCTTACACACATTTAAGTTAGGGTTCACTG
 
. : . : . : . : . : . :
rJMFF012G19- CTTTCGCAAAGCAACTGCCAGATCTCGGCGCATTGCATTGCGATCCTGGCTGCAGGCTGT
rJMFF031P10- CTTTCGCAAAGCAACTGCCAGATCTCGGCGCATTGCATTGCGATCCTGGCTGCAGGCTGT
JMFF012G19+ CTTTCGCAAAGCAACTGCCAGATCTCGGCGCATTGCATTGCGATCCTGGCTGCAGGCTGT
JMFN032N20+ CTTTCGCAAAGCAACTGCCAGATCTCGGCGCATTGCATTGCGATCCTGGCTGCAGGCTGT
JMFF031P10+ CTTTCGCAAAGCAACTGCCAGATCTCGGCGCATTGCATTGCGATCCTGGCTGCAGGCTGT
JMFN019P19+ CTTTCGCAAAGCAACTGCCAGATCTCGGCGAATTGCATTGCGATCCTGGCTGCAGGCTGT
JMFN004H10+ CTTTCGCAAAGCAACTGCCAGATCTCGGCGCATTGCATTGCGATCCTGGCTGCAGGCTGT
                      ____________________________________________________________
consensus CTTTCGCAAAGCAACTGCCAGATCTCGGCGCATTGCATTGCGATCCTGGCTGCAGGCTGT
 
. : . : . : . : . : . :
rJMFF012G19- TGTAGACAAGTGTTTTAGATCCGCCATCAAGAAACCAGGCAGAAGTCTGGGAATCCATCA
rJMFF031P10- TGTAGACAAGTGTTTTAGATCCGCCATCAAGAAACCAGGCAGAAGTCTGGGAATCCATCA
JMFF012G19+ TGTAGACAAGTGTTTTAGATCCGCCATCAAGAAACCAGGCAGAAGTCTGGGAATCCATCA
JMFN032N20+ TGTAGACAAGTGTTTTAGATCCGCCATCAAGAAACCAGGCAGAAGTCTGGGAATCCATCA
JMFF031P10+ TGTAGACAAGTGTTTTAGATCCGCCATCAAGAAACCAGGCAGAAGTCTGGGAATCCATCA
JMFN019P19+ TGTAGACAAGTGTTTTAGATCCGCCATCAAGAAACCAGGCAGAAGTCTGGGAATCCATCA
JMFN004H10+ TGTAGACAAGTGTTTTAGATCCGCCATCAAGAAACCAGGCAGAAGTCTGGGAATCCATCA
                      ____________________________________________________________
consensus TGTAGACAAGTGTTTTAGATCCGCCATCAAGAAACCAGGCAGAAGTCTGGGAATCCATCA
 
. : . : . : . : . : . :
rJMFF012G19- TCAGGAACTCTTCGCCGCCGTCGTCTCCGGGCGCAGCAGTGCATCCGGCGGCACCACCGC
rJMFF031P10- TCAGGAACTCTTCGCCGCCGTCGTCTCCGGGCGCAGCAGTGCATCCGGCGGCACCACCGC
JMFF012G19+ TCAGGAACTCTTCGCCGCCGTCGTCTCCGGGCGCAGCAGTGCATCCGGCGGCACCACCGC
JMFN032N20+ TCAGGAACTCTTCGCCGCCGTCGTCTCCGGGCGCAGCAGTGCATCCGGCGGCACCACCGC
JMFF031P10+ TCAGGAACTCTTCGCCGCCGTCGTCTCCGGGCGCAGCAGTGCATCCGGCGGCACCACCGC
JMFN019P19+ TCAGGAACTCTTCGCCGCCGTCGTCTCCGGGCGCAGCAGTGCATCCGGCGGCACCACCGC
JMFN004H10+ TCAGGAACTCTTCGCCGCCGTCGTCTCCGGGCGCAGCAGTGCATCCGGCGGCACCACCGC
                      ____________________________________________________________
consensus TCAGGAACTCTTCGCCGCCGTCGTCTCCGGGCGCAGCAGTGCATCCGGCGGCACCACCGC
 
. : . : . : . : . : . :
rJMFF012G19- AGTTTTGGCCGCCGGAGTTGCTGTTGTGGTGGTTATTAGCTGCGGCAGATTCGGCACCGG
rJMFF031P10- AGTTTTGGCCGCCGGAGTTGCTGTTGTGGTGGTTATTAGCTGCGGCAGATTCGGCACCGG
JMFF012G19+ AGTTTTGGCCGCCGGAGTTGCTGTTGTGGTGGTTATTAGCTGCGGCAGATTCGGCACCGG
JMFN032N20+ AGTTTTGGCCGCCGGAGTTGCTGTTGTGGTGGTTATTAGCTGCGGCAGA
JMFF031P10+ AGTTTTGGCCGCCGGAGTTGCTGTTGTGGTGGTTATTAGCTGCGGCAGATTCGGCACCGG
JMFN019P19+ AGTTTTGGCCGCCGGAGTTGCTGTTGTGGTGGTTATTAGCTGCGGCAGATTCGGCACCGG
JMFN004H10+ AGTTTTGGCCGCCGGAGTTGCTGTTGTGGTGGTTATTAGCTGCGGCAGATTCGGCACCGG
                      ____________________________________________________________
consensus AGTTTTGGCCGCCGGAGTTGCTGTTGTGGTGGTTATTAGCTGCGGCAGATTCGGCACCGG
 
. : . : . : . : . : . :
rJMFF012G19- TGGTGATGAACAGAGCGATGAAGATGGCTGCACTAATGTTGCAGTAACGTGCCATATTCG
rJMFF031P10- TGGTGATGAACAGAGCGATGAAGATGGCTGCACTAATGTTGCAGTAACGTGCCATATTCG
JMFF012G19+ TGGTGATGAACAGAGCGATGAAGATGGCTGCACTAATGTTGCAGTAACGTGCCATATTCG
JMFF031P10+ TGGTGATGAACAGAGCGATGAAGATGGCTGCACTAATGTTGCAGTAACGTGCCATATTCG
JMFN019P19+ TGGTGATGAACAGAGCGATGAAGATGGCTGCACTAATGTTGCAGTAACGTGCCATATTCG
JMFN004H10+ TGGTGATGAACAGAGCGATGAAGATGGCTGCACTAATGTTGCAGTAACGTGCCATATTCG
                      ____________________________________________________________
consensus TGGTGATGAACAGAGCGATGAAGATGGCTGCACTAATGTTGCAGTAACGTGCCATATTCG
 
. : . : . : . : . : . :
rJMFF012G19- CTTCACTTCTACTCTTTTCGTGGGCAGAGAAAT
rJMFF031P10- CTTCACTTCTACTCTTTTCGTGGGCAGAGAAATGT
JMFF012G19+ CTTCACTTCTACTCTTTTCGTGGGCAGAGAAAT
JMFF031P10+ CTTCACTTCTACTCTTTTCGTGGGCAGAGAAATGT
JMFN019P19+ CTTCACTTCTACTCTTTTCGTGGGCAGAGAAATGTGAGGATTGAATTTTATATAGTGCT
JMFN004H10+ CTTCACTTCTACTCTTTTCGTGGGCAGAGAAATGTGAGGATTGAATTTTATATAGTGCTT
                      ____________________________________________________________
consensus CTTCACTTCTACTCTTTTCGTGGGCAGAGAAATGTGAGGATTGAATTTTATATAGTGCTT
 
. : . : . : . : . : . :
JMFN004H10+ ATTATAGCATTGGGATTTCTTGCTAGTTGCTAGCTGCATATCAATGTCAAGGGGACACCC
                      ____________________________________________________________
consensus ATTATAGCATTGGGATTTCTTGCTAGTTGCTAGCTGCATATCAATGTCAAGGGGACACCC