Previous Contig 002257:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019A12Sequence500002257 (7)gb:AC105770_17382194e-47Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_D02, complete s760002257 (7)gb:AC105770_17382194e-60Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_D02, complete s
JMFF032I04Sequence501002257 (7)gb:AC105770_17382194e-47Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_D02, complete s726002257 (7)gb:AC105770_17382193e-60Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_D02, complete s
JMFN004A22Sequence627002257 (7)gb:AC105770_17382193e-60Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_D02, complete s
JMFN004D23Sequence595002257 (7)gb:AC105770_17382193e-47Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_D02, complete s
JMFN009F13Sequence619002257 (7)gb:AC105770_17382192e-60Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_D02, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF019A12- TTCCTTTCCTTCGCTGAATTCTCCAGAATTATGTGACAATTAATGATAGTATTAGAA
                      ____________________________________________________________
consensus TTCCTTTCCTTCGCTGAATTCTCCAGAATTATGTGACAATTAATGATAGTATTAGAA
 
. : . : . : . : . : . :
JMFN004D23+ AAGTTAACAAAGTGCCCAAAGCATAATATTTGAGAAACGTCTGAATTTAC
rJMFF019A12- ACCATTAATTAAGTTAACAAAGTGCCCAAAGCATAATATTTGAGAAACGTCTGAATTTAC
rJMFF032I04- AAGTTAACAAAGTGCCCAAAGCATAATATTTGAGAAACGTCTGAATTTAC
                      ____________________________________________________________
consensus ACCATTAATTAAGTTAACAAAGTGCCCAAAGCATAATATTTGAGAAACGTCTGAATTTAC
 
. : . : . : . : . : . :
JMFN004D23+ CGTTGAAACATAAGGATCAATGTCACGCCGCACTTCAAGTACATCAAAAATGAAAATAGC
rJMFF019A12- CGTTGAAACATAAGGATCAATGTCACGCCGCACTTCAAGTACATCAAAAATGAAAATAGC
rJMFF032I04- CGTTGAAACATAAGGATCAATGTCACGCCGCACTTCAAGTACATCAAAAATGAAAATAGC
JMFN009F13+ AAATAGC
                      ____________________________________________________________
consensus CGTTGAAACATAAGGATCAATGTCACGCCGCACTTCAAGTACATCAAAAATGAAAATAGC
 
. : . : . : . : . : . :
JMFN004D23+ AACGTCGGTCCATAAACTTCTACTTAGCTTTTCCTTTTCCTTTCCCTTTTTTTGCTTCAA
rJMFF019A12- AACGTCGGTCCATAAACTTCTACTTAGCTTTTCCTTTTCCTTTCCCTTTTTTTGCTTCAA
rJMFF032I04- AACGTCGGTCCATAAACTTCTACTTAGCTTTTCCTTTTCCTTTCCCTTTTTTTGCTTCAA
JMFN009F13+ AACGTCGGTCCATAAACTTCTACTTAGCTTTTCCTTTTCCTTTCCCTTTTTNTGCTTCAA
                      ____________________________________________________________
consensus AACGTCGGTCCATAAACTTCTACTTAGCTTTTCCTTTTCCTTTCCCTTTTTTTGCTTCAA
 
. : . : . : . : . : . :
JMFN004D23+ GCTTGGCTTGGATACGGGCGGCAGCTGCTGCCTTAGCTTCTTCTCTCTTCTTCTTCTCCT
rJMFF019A12- GCTTGGCTTGGATACGGGCGGCAGCTGCTGCCTTAGCTTCTTCTCTCTTCTTCTTCTCCT
rJMFF032I04- GCTTGGCTTGGATACGGGCGGCAGCTGCTGCCTTAGCTTCTTCTCTCTTCTTCTTCTCCT
JMFN009F13+ GCTTGGCTTGGATACGGGCGGCAGCTGCTGCCTTAGCTTCTTCTCTCTTCTTCTTCTCCT
JMFN004A22+ TAGCTTCTTCTCTCTTCTTCTTCTCCT
                      ____________________________________________________________
consensus GCTTGGCTTGGATACGGGCGGCAGCTGCTGCCTTAGCTTCTTCTCTCTTCTTCTTCTCCT
 
. : . : . : . : . : . :
JMFN004D23+ CCTCCTTGTTTGCAGCTGCAAGTTCCCTCTGTTTCTTTAGCTCCTCCAGCCTAGCCTTTT
rJMFF019A12- CCTCCTTGTTTGCAGCTGCAAGTTCCCTCTGTTTCTTTAGCTCCTCCAGCCTAGCCTTTT
rJMFF032I04- CCTCCTTGTTTGCAGCTGCAAGTTCCCTCTGTTTCTTTAGCTCCTCCAGCCTAGCCTTTT
JMFN009F13+ CCTCCTTGTTTGCAGCTGCAAGTTCCCTCTGTTTCTTTAGCTCCTCCAGCCTAGCCTTTT
JMFN004A22+ CCTCCTTGTTTGCAGCTGCAAGTTCCCTCTGTTTCTTTAGCTCCTCCAGCCTAGCCTTTT
                      ____________________________________________________________
consensus CCTCCTTGTTTGCAGCTGCAAGTTCCCTCTGTTTCTTTAGCTCCTCCAGCCTAGCCTTTT
 
. : . : . : . : . : . :
JMFN004D23+ CATCTGAGACACTGCCCAAGCTAGAACCTTTCCTAGGTCGACAAGCCGCTAGTTCCACCT
rJMFF019A12- CATCTGAGACACTGCCCAAGCTAGAACCTTTCCTAGGTCGACAAGCCGCTAGTTCCACCT
rJMFF032I04- CATCTGAGACACTGCCCAAGCTAGAACCTTTCCTAGGTCGACAAGCCGCTAGTTCCACCT
JMFN009F13+ CATCTGAGACACTGCCCAAGCTAGAACCTTTCCTAGGTCGACAAGCCGCTAGTTCCACCT
JMFF019A12+ GTCGACAAGCCGCTAGTTCCACCT
JMFF032I04+ GGTCGACAAGCCGCTAGTTCCACCT
JMFN004A22+ CATCTGAGACACTGCCCAAGCTAGAACCTTTCCTAGGTCGACAAGCCGCTAGTTCCACCT
                      ____________________________________________________________
consensus CATCTGAGACACTGCCCAAGCTAGAACCTTTCCTAGGTCGACAAGCCGCTAGTTCCACCT
 
. : . : . : . : . : . :
JMFN004D23+ CAAATATAAGTGTTGCATCCGGAGGAATATCTGGTGGAGAACCTGCACTGCCATAGGCAT
rJMFF019A12- CAAATATAAGTGTTGCATCCGGAGGAATATCTGGTGGAGAACCTGCACTGCCATAGGCAT
rJMFF032I04- CAAATATAAGTGTTGCATCCGGAGGAATATCTGGTGGAGAACCTGCACTGCCATAGGCAT
JMFN009F13+ CAAATATAAGTGTTGCATCCGGAGGAATATCTGGTGGAGAACCTGCACTGCCATAGGCAT
JMFF019A12+ CAAATATAAGTGTTGCATCCGGAGGAATATCTGGTGGAGAACCTGCACTGCCATAGGCAT
JMFF032I04+ CAAATATAAGTGTTGCATCCGGAGGAATATCTGGTGGAGAACCTGCACTGCCATAGGCAT
JMFN004A22+ CAAATATAAGTGTTGCATCCGGAGGAATATCTGGTGGAGAACCTGCACTGCCATAGGCAT
                      ____________________________________________________________
consensus CAAATATAAGTGTTGCATCCGGAGGAATATCTGGTGGAGAACCTGCACTGCCATAGGCAT
 
. : . : . : . : . : . :
JMFN004D23+ ATTCTGGTTTGCAGGTGATTACAGCTACCTCCCCAACCTTCATGGTTCTCAGTGCAACAT
rJMFF019A12- ATTCTGGTTTGCAGGTGATTACAGCTACCTCCCCAACCTTCATGGTTCTCAGTGCAACAT
rJMFF032I04- ATTCTGGTTTGCAGGTGATTACAGCTACCTCCCCAACCTTCATGGTTCTCAGTGCAACAT
JMFN009F13+ ATTCTGGTTTGCAGGTGATTACAGCTACCTCCCCAACCTTCATGGTTCTCAGTGCAACAT
JMFF019A12+ ATTCTGGTTTGCAGGTGATTACAGCTACCTCCCCAACCTTCATGGTTCTCAGTGCAACAT
JMFF032I04+ ATTCTGGTTTGCAGGTGATTACAGCTACCTCCCCAACCTTCATGGTTCTCAGTGCAACAT
JMFN004A22+ ATTCTGGTTTGCAGGTGATTACAGCTACCTCCCCAACCTTCATGGTTCTCAGTGCAACAT
                      ____________________________________________________________
consensus ATTCTGGTTTGCAGGTGATTACAGCTACCTCCCCAACCTTCATGGTTCTCAGTGCAACAT
 
. : . : . : . : . : . :
JMFN004D23+ CCCAAGCCTTGATGACAGATCCCTTGCCTATCTCAAACGTGAACACTGTATTGTCCTCAC
rJMFF019A12- CCCAAGCCTTGATGACAGATCCCTTGCCTATCTCAAACGTGAACACTGTATTGTCCTCAC
rJMFF032I04- CCCAAGCCTTGATGACAGATCCCTTGCCTATCTCAAACGTGAACACTGTATTGTCCTCAC
JMFN009F13+ CCCAAGCCTTGATGACAGATCCCTTGCCTATCTCAAACGTGAACACTGTATTGTCCTCAC
JMFF019A12+ CCCAAGCCTTGATGACAGATCCCTTGCCTATCTCAAACGTGAACACTGTATTGTCCTCAC
JMFF032I04+ CCCAAGCCTTGATGACAGATCCCTTGCCTATCTCAAACGTGAACACTGTATTGTCCTCAC
JMFN004A22+ CCCAAGCCTTGATGACAGATCCCTTGCCTATCTCAAACGTGAACACTGTATTGTCCTCAC
                      ____________________________________________________________
consensus CCCAAGCCTTGATGACAGATCCCTTGCCTATCTCAAACGTGAACACTGTATTGTCCTCAC
 
. : . : . : . : . : . :
JMFN004D23+ GGGTAGTATCAAATACTTCACCAGTCTCGGCAAGA
rJMFF019A12- GGGTAGTATCAAATACTTCACCAGTCTCGGCAAGAGTACCTTCATAGTGCACATCAACAA
rJMFF032I04- GGGTAGTATCAAATACTTCACCAGTCTCGGCAAGAGTACCTTCATAGTGCACATCAACAA
JMFN009F13+ GGGTAGTATCAAATACTTCACCAGTCTCGGCAAGAGTACCTTCATAGTGCACATCAACAA
JMFF019A12+ GGGTAGTATCAAATACTTCACCAGTCTCGGCAAGAGTACCTTCATAGTGCACATCAACAA
JMFF032I04+ GGGTAGTATCAAATACTTCACCAGTCTCGGCAAGAGTACCTTCATAGTGCACATCAACAA
JMFN004A22+ GGGTAGTATCAAATACTTCACCAGTCTCGGCAAGAGTACCTTCATAGTGCACATCAACAA
                      ____________________________________________________________
consensus GGGTAGTATCAAATACTTCACCAGTCTCGGCAAGAGTACCTTCATAGTGCACATCAACAA
 
. : . : . : . : . : . :
rJMFF019A12- GAGGAAGACCCTCTGATGGAGCAATAGCATCAGCCTTGGCTCGCCGGACAATTTTTTTCA
rJMFF032I04- GAGGAAGACCCTCTGATGGAGCAATAGCATCAGCCTTGGCTCGCCGGACAATTTTTTTCA
JMFN009F13+ GAGGAAGACCCTCTGATGGAGCAATAGCATCAGCCTTGGCTCGCCGGACAATTTTTTTCA
JMFF019A12+ GAGGAAGACCCTCTGATGGAGCAATAGCATCAGCCTTGGCTCGCCGGACAATTTTTTTCA
JMFF032I04+ GAGGAAGACCCTCTGATGGAGCAATAGCATCAGCCTTGGCTCGCCGGACAATTTTTTTCA
JMFN004A22+ GAGGAAGACCCTCTGATGGAGCAATAGCATCAGCCTTGGCTCGCCGGACAATTTTTTTCA
                      ____________________________________________________________
consensus GAGGAAGACCCTCTGATGGAGCAATAGCATCAGCCTTGGCTCGCCGGACAATTTTTTTCA
 
. : . : . : . : . : . :
rJMFF019A12- AAACTCCTCCATCTCCAGTTAAATCAACAGTGTCACCCATAGC
rJMFF032I04- AAACTCCTCCATCTCCAGTTAAATCAACAGTGTCACCCATAGCTCCTAAACCTTCAACAG
JMFN009F13+ AAACTCCTCCATCTCCAGTTAAATCAACAGTGTCACCCATAGCTCCTAAACCTTCAACAG
JMFF019A12+ AAACTCCTCCATCTCCAGTTAAATCAACAGTGTCACCCATAGCTCCTAAACCTTCAACAG
JMFF032I04+ AAACTCCTCCATCTCCAGTTAAATCAACAGTGTCACCCATAGCTCCTAAACCTTCAACAG
JMFN004A22+ AAACTCCTCCATCTCCAGTTAAATCAACAGTGTCACCCATAGCTCCTAAACCTTCAACAG
                      ____________________________________________________________
consensus AAACTCCTCCATCTCCAGTTAAATCAACAGTGTCACCCATAGCTCCTAAACCTTCAACAG
 
. : . : . : . : . : . :
rJMFF032I04- CCTGAATGGAG
JMFN009F13+ CCTGAATGGAGA
JMFF019A12+ CCTGAATGGAGAGGACAGTCGTCGATAGGCGGCCGGAGAGAGAGGAGACAGGTAAAGGTA
JMFF032I04+ CCTGAATGGAGGGGACAGTCGTCGATAGGCGGCCGGAGAGAGAGGAGACAGGTAAAGGTA
JMFN004A22+ CCTGAATGGAGAGGACAGTCGTCGATAGGCGGCCGGAGAGAGAGGAGACAGGTAAAGGTA
                      ____________________________________________________________
consensus CCTGAATGGAGAGGACAGTCGTCGATAGGCGGCCGGAGAGAGAGGAGACAGGTAAAGGTA
 
. : . : . : . : . : . :
JMFF019A12+ ATTAGGAGAAATGGAGGGGTAAAACGGGAAACTTCGGTGGTAGAAGTTGAAATCGT
JMFF032I04+ ATTAGGAGAAATGGAGGGGTAAAACGGGAAACTTCGGTGGTAGAAGTTGAAATCGT
JMFN004A22+ ATTAGGAGAAATGGAGGGGTAAAACGGGAAACTTCGGTGGTAGAAGTTGAAATCGTCGGC
                      ____________________________________________________________
consensus ATTAGGAGAAATGGAGGGGTAAAACGGGAAACTTCGGTGGTAGAAGTTGAAATCGTCGGC