Previous Contig 002250:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN003L15Sequence620002250 (10)pir|T50822|T508223e-29ribosomal protein S26, cytosolic [imported] - garden pea>gb:AF112440_1769089 Pis
JMFN010B22Sequence626002250 (10)pir|T50822|T508223e-29ribosomal protein S26, cytosolic [imported] - garden pea>gb:AF112440_1769089 Pis
JMFN029L21Sequence589002250 (10)pir|T50822|T508223e-29ribosomal protein S26, cytosolic [imported] - garden pea>gb:AF112440_1769089 Pis
JMFN032I02Sequence613002250 (10)pir|T50822|T508223e-29ribosomal protein S26, cytosolic [imported] - garden pea>gb:AF112440_1769089 Pis
JMFN033A11Sequence484002250 (10)pir|T50822|T508223e-20ribosomal protein S26, cytosolic [imported] - garden pea>gb:AF112440_1769089 Pis
JMFN039A19Sequence606002250 (10)pir|T50822|T508223e-29ribosomal protein S26, cytosolic [imported] - garden pea>gb:AF112440_1769089 Pis
JMSF001K08Sequence345002250 (10)pir|T50822|T508222e-34ribosomal protein S26, cytosolic [imported] - garden pea>gb:AF112440_1769089 Pis587002250 (10)pir|T50822|T508223e-29ribosomal protein S26, cytosolic [imported] - garden pea>gb:AF112440_1769089 Pis
JMSF009M03Sequence349002250 (10)pir|T50822|T508226e-35ribosomal protein S26, cytosolic [imported] - garden pea>gb:AF112440_1769089 Pis146002250 (10)pir|T50823|T508231e-15ribosomal protein S26 homolog [imported] - alfalfa>gb:AF084202_1767058 Medicago

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN033A11+ TCAAAAATAATATTTCATAG
JMFN032I02+ AAGGTTCTCAAAAATAATATTTCATAG
JMFN029L21+ ATAG
JMFN039A19+ CAAAAATAATATTTCATAG
JMFN010B22+ TCAAAAATAATATTTCATAG
JMFN003L15+ TCAAAAATAATATTTCATAG
                      ____________________________________________________________
consensus AAGGTTCTCAAAAATAATATTTCATAG
 
. : . : . : . : . : . :
rJMSF001K08- AATAGAACAATTTGATAATTAGTCTGAACTGA
JMFN033A11+ AACAAGAATCTCTTTGTTTTCCATACTAAATAGAACAATTTGATAATTAGTCTGAACTGA
JMFN032I02+ AACAAGAATCTCTTTGTTTTCCATACTAAATAGAACAATTTGATAATTAGTCTGAACTGA
JMFN029L21+ AACAAGAATCTCT-TGTTTTCCATACTAAATAGAACAATTGNATAATTAGTCTGAACTGA
JMFN039A19+ AACAAGAATCTCT-TGTTTTCCATACTAAATAGAACAATTTGATAATTAGTCTGAACTGA
JMFN010B22+ AACAAGAATCTCTNTGTTTTCCATACTAAATAGAACAATTTGATAATTAGTCTGAACTGA
JMFN003L15+ AACAAGAATCTCTNTGTTTTCCATACTAAATAGAACAATNTGATAATTAGTCTGAACTGA
                      ____________________________________________________________
consensus AACAAGAATCTCTTTGTTTTCCATACTAAATAGAACAATTTGATAATTAGTCTGAACTGA
 
. : . : . : . : . : . :
rJMSF001K08- AACAGAACATAATGAAAAAAACTAGCAGCATCTATAACTTGCATAACCTTAAAGGAATGC
JMFN033A11+ AACAGAACATAATGAAAAAAACTAGCAGCATCTATAACTTGCATAACCTTAAAGGAATGC
JMFN032I02+ AACAGAACATAATGAAAAAAACTAGCAGCATCTATAACTTGCATAACCTTAAAGGAATGC
JMFN029L21+ AACAGAACATAATGAAAAAAACTAGCAGCATCTATAACTTGCATAACCTTAAAGGAATGC
JMFN039A19+ AACAGAACATAATGAAAAAAACTAGCAGCATCTATAACTTGCATAACCTTAAAGGAATGC
JMFN010B22+ AACAGAACATAATGAAAAAAACTAGCAGCATCTATAACTTGCATAACCTTAAAGGAATGC
JMFN003L15+ AACAGAACATAATGAAAAAAACTAGCAGCATCTATAACTTGCATAACCTTAAAGGAATGC
                      ____________________________________________________________
consensus AACAGAACATAATGAAAAAAACTAGCAGCATCTATAACTTGCATAACCTTAAAGGAATGC
 
. : . : . : . : . : . :
rJMSF001K08- CAAAAACTCTCATAATAAGGCAAATCAATCAGTGAGCATCC-TCTAAGTTCTGGGAGCCG
JMFN033A11+ CAAAAACTCTCATAATAAGGCAAATCAATCAGTGAGCATCCTTCTAAGTTCTGGGAGCCG
JMFN032I02+ CAAAAACTCTCATAATAAGGCAAATCAATCAGTGAGCATCCTTCTAAGTTCTGGGAGCCG
JMFN029L21+ CAAAAACTCTCATAATAAGGCAAATCAATCAGTGAGCATCCTTCTAAGTTCTGGGAGCCG
JMFN039A19+ CAAAAACTCTCATAATAAGGCAAATCAATCAGTGAGCATCCTTCTAAGTTCTGGGAGCCG
JMFN010B22+ CAAAAACTCTCATAATAAGGCAAATCAATCAGTGAGCATCCTTCTAAGTTCTGGGAGCCG
JMFN003L15+ CAAAAACTCTCATAATAAGGCAAATCAATCAGTGAGCATCCTTCTAAGTTCTGGGAGCCG
                      ____________________________________________________________
consensus CAAAAACTCTCATAATAAGGCAAATCAATCAGTGAGCATCCTTCTAAGTTCTGGGAGCCG
 
. : . : . : . : . : . :
rJMSF001K08- TTGGAGCTCCAGCGGGCCTTGGAGCTTGACCAGGCTTTGGCTGATCATCCCTAGGGCGTC
JMFN033A11+ TTGGAGCTCCAGCGGGCCTTGGAGCTTGACCAGGCTTTGGCTGATCATCCCTAGGGCGTC
JMFN032I02+ TTGGAGCTCCAGCGGGCCTTGGAGCTTGACCAGGCTTTGGCTGATCATCCCTAGGGCGTC
JMFN029L21+ TTGGAGCTCCAGCGGGCCTTGGAGCTTGACCAGGCTTTGGCTGATCATCCCTAGGGCGTC
JMFN039A19+ TTGGAGCTCCAGCGGGCCTTGGAGCTTGACCAGGCTTTGGCTGATCATCCCTAGGGCGTC
JMFN010B22+ TTGGAGCTCCAGCGGGCCTTGGAGCTTGACCAGGCTTTGGCTGATCATCCCTAGGGCGTC
JMFN003L15+ TTGGAGCTCCAGCGGGCCTTGGAGCTTGACCAGGCTTTGGCTGATCATCCCTAGGGCGTC
                      ____________________________________________________________
consensus TTGGAGCTCCAGCGGGCCTTGGAGCTTGACCAGGCTTTGGCTGATCATCCCTAGGGCGTC
 
. : . : . : . : . : . :
rJMSF001K08- TGAAGCGTTGTGGAGCTTCACGGATCCTTCTATCGGTACGAGAGCGGACCCTGACAACCT
JMFN033A11+ TGAAGCGTTGTGGAGCTTCACGGATCCTTCTATCGGTACGAGAGCGGACCCTGACAACCT
JMSF009M03+ TCTATCGGTACGAGAGCGGACCCTGACAACCT
JMSF001K08+ ATCGGTACGAGAGCGGACCCTGACAACCT
JMFN032I02+ TGAAGCGTTGTGGAGCTTCACGGATCCTTCTATCGGTACGAGAGCGGACCCTGACAACCT
JMFN029L21+ TGAAGCGTTGTGGAGCTTCACGGATCCTTCTATCGGTACGAGAGCGGACCCTGACAACCT
JMFN039A19+ TGAAGCGTTGTGGAGCTTCACGGATCCTTCTATCGGTACGAGAGCGGACCCTGACAACCT
JMFN010B22+ TGAAGCGTTGTGGAGCTTCACGGATCCTTCTATCGGTACGAGAGCGGACCCTGACAACCT
JMFN003L15+ TGAAGCGTTGTGGAGCTTCACGGATCCTTCTATCGGTACGAGAGCGGACCCTGACAACCT
                      ____________________________________________________________
consensus TGAAGCGTTGTGGAGCTTCACGGATCCTTCTATCGGTACGAGAGCGGACCCTGACAACCT
 
. : . : . : . : . : . :
rJMSF001K08- TGGAATGAATTGCGCAGGAAACACAGTACTGCATCTTCAAGTAGAGCTTGGGAAGTGTGT
JMFN033A11+ TGGAATGAATTGCGCAGGAAACACAGTACTGCATCTTCAAGTAGAGCTTGGGAAGTGTGT
JMSF009M03+ TGGAATGAATTGCGCAGGAAACACAGTACTGCATCTTCAAGTAGAGCTTGGGAAGTGTGT
JMSF001K08+ TGGAATGAATTGCGCAGGAAACACAGTACTGCATCTTCAAGTAGAGCTTGGGAAGTGTGT
JMFN032I02+ TGGAATGAATTGCGCAGGAAACACAGTACTGCATCTTCAAGTAGAGCTTGGGAAGTGTGT
JMFN029L21+ TGGAATGAATTGCGCAGGAAACACAGTACTGCATCTTCAAGTAGAGCTTGGGAAGTGTGT
JMFN039A19+ TGGAATGAATTGCGCAGGAAACACAGTACTGCATCTTCAAGTAGAGCTTGGGAAGTGTGT
JMFN010B22+ TGGAATGAATTGCGCAGGAAACACAGTACTGCATCTTCAAGTAGAGCTTGGGAAGTGTGT
rJMSF009M03- GTACTGCATCTTCAANTACAGCTTGNGAAGTGTGT
JMFN003L15+ TGGAATGAATTGCGCAGGAAACACAGTACTGCATCTTCAAGTAGAGCTTGGGAAGTGTGT
                      ____________________________________________________________
consensus TGGAATGAATTGCGCAGGAAACACAGTACTGCATCTTCAAGTAGAGCTTGGGAAGTGTGT
 
. : . : . : . : . : . :
rJMSF001K08- AACTTTCAAAAGCACAAGCCTCTTGGACATCCCTAACTGCTGCTTGTTCAACAATGTTCC
JMFN033A11+ AACTTTCAAAAGCATAAGCCTCTTGGACATCCCTAACTGCTGCTTGTTCAACAATGTTCC
JMSF009M03+ AACTTTCAAAAGCACAAGCCTCTTGGACATCCCTAACTGCTGCTTGTTCAACAATGTTCC
JMSF001K08+ AACTTTCAAAAGCACAAGCCTCTTGGACATCCCTAACTGCTGCTTGTTCAACAATGTTCC
JMFN032I02+ AACTTTCAAAAGCACAAGCCTCTTGGACATCCCTAACTGCTGCTTGTTCAACAATGTTCC
JMFN029L21+ AACTTTCAAAAGCACAAGCCTCTTGGACATCCCTAACTGCTGCTTGTTCAACAATGTTCC
JMFN039A19+ AACTTTCAAAAGCACAAGCCTCTTGGACATCCCTAACTGCTGCTTGTTCAACAATGTTCC
JMFN010B22+ AACTTTCAAAAGCACAAGCCTCTTGGACATCCCTAACTGCTGCTTGTTCAACAATGTTCC
rJMSF009M03- AACTTTCANAAGCACNANCCTCTTGGACATCCCTAACTGCTGCTTGTTCAACAATGTTCC
JMFN003L15+ AACTTTCAAAAGCACAAGCCTCTTGGACATCCCTAACTGCTGCTTGTTCAACAATGTTCC
                      ____________________________________________________________
consensus AACTTTCAAAAGCACAAGCCTCTTGGACATCCCTAACTGCTGCTTGTTCAACAATGTTCC
 
. : . : . : . : . : . :
rJMSF001K08- TAACAAGGAATCTCTTAATGGCCTTATCCTTTGGGCAGCATTTACCGCAGTTGGAGCAGC
JMFN033A11+ TAACAAGGAATCTCTTAATGGCCTTATCCTTTGGGCAG
JMSF009M03+ TAACAAGGAATCTCTTAATGGCCTTATCCTTTGGGCAGCATTTACCGCAGTTGGAGCAGC
JMSF001K08+ TAACAAGGAATCTCTTAATGGCCTTATCCTTTGGGCAGCATTTACCGCAGTTGGAGCAGC
JMFN032I02+ TAACAAGGAATCTCTTAATGGCCTTATCCTTTGGGCAGCATTTACCGCAGTTGGAGCAGC
JMFN029L21+ TAACAAGGAATCTCTTAATGGCCTTATCCTTTGGGCAGCATTTACCGCAGTTGGAGCAGC
JMFN039A19+ TAACAAGGAATCTCTTAATGGCCTTATCCTTTGGGCAGCATTTACCGCAGTTGGAGCAGC
JMFN010B22+ TAACAAGGAATCTCTTAATGGCCTTATCCTTTGGGCAGCATTTACCGCAGTTGGAGCAGC
rJMSF009M03- TAACAAGGAATCTCTTAATGGCCTTATCCTTTGGGCAGCATTTACCGCAGT
JMFN003L15+ TAACAAGGAATCTCTTAATGGCCTTATCCTTTGGGCAGCATTTACCGCAGTTGGAGCAGC
                      ____________________________________________________________
consensus TAACAAGGAATCTCTTAATGGCCTTATCCTTTGGGCAGCATTTACCGCAGTTGGAGCAGC
 
. : . : . : . : . : . :
rJMSF001K08- GGATGAAGTTAACGTGGCCACGGCCGTGCTTGTTGCGGCCACCATTCCTTCGCTTGAATG
JMSF009M03+ GGATGAAGTTAACGTGGCCACGGCCGTGCTTGTTGCGGCCACCATTCCTTCGCTTGAATG
JMSF001K08+ GGATGAAGTTAACGTGGCCACGGCCGTGCTTGTTGCGGCCACCATTCCTTCGCTTGAATG
JMFN032I02+ GGATGAAGTTAACGTGGCCACGGCCGTGCTTGTTGCGGCCACCATTCCTTCGCTTGAATG
JMFN029L21+ GGATGAAGTTAACGTGGCCACGGCCGTGCTTGTTGCGGCCACCATTCCTTCGCTTGAATG
JMFN039A19+ GGATGAAGTTAACGTGGCCACGGCCGTGCTTGTTGCGGCCACCATTCCTTCGCTTGAATG
JMFN010B22+ GAATGAAGTTAACGTGGCCACGGCCGTGCTTGTTGCGGCCACCATTCCTTCGCTTGAATG
JMFN003L15+ GGATGAAGTTAACGTGGCCACGGCCGTGCTTGTTGCGGCCACCATTCCTTCGCTTGAATG
                      ____________________________________________________________
consensus GGATGAAGTTAACGTGGCCACGGCCGTGCTTGTTGCGGCCACCATTCCTTCGCTTGAATG
 
. : . : . : . : . : . :
rJMSF001K08- TCATTTTT
JMSF009M03+ TCATTTTT
JMSF001K08+ TCATTTTT
JMFN032I02+ TCATTTTTGCGGTGTAGACGAAGGCAGCCGGTACAGCTCGGAACTC
JMFN029L21+ TCATTTTTGCGGTGTAGACGAAGGCAGCCGGTACAGCTCGGAACTC
JMFN039A19+ TCATTTTTGCGGTGTAGACGAAGGCAGCCGGTACAGCTCGGAACTCCA
JMFN010B22+ TCATTTTTGCGGTGTAGACGAAGGCAGCCGGTACAGCTCGGAACTCCAATGGCTGAACTC
JMFN003L15+ TCATTTTTGCGGTGTAGACGAAGGCAGCCGGTACAGCTCGGAACTCCAATGGCTGAACTC
                      ____________________________________________________________
consensus TCATTTTTGCGGTGTAGACGAAGGCAGCCGGTACAGCTCGGAACTCCAATGGCTGAACTC