Previous Contig 002243:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN003C18Sequence613002243 (3)gb:AF321854_12624887e-09Plasmodium atheruri circumsporozoite protein gene, complete cds.
JMFN019E05Sequence627002243 (3)gb:HS1LATA_24370700.006Herpes simplex virus type one (HSV-1) latency associated transcript (LAT).
JMFN043O09Sequence633002243 (3)pir|H85120|H851201e-06probable proline-rich protein [imported] - Arabidopsis thaliana>gb:ATCHRIV31_154

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN019E05+ ACGGGGGAGACTACTCGGGGGGTATCTTTGATTG
                      ____________________________________________________________
consensus ACGGGGGAGACTACTCGGGGGGTATCTTTGATTG
 
. : . : . : . : . : . :
JMFN019E05+ TGGGTTATGGAGCGCAAAAGGCCCTCGCTTTATTGCGGAAGTTAGGGTCACTGAACTTTT
                      ____________________________________________________________
consensus TGGGTTATGGAGCGCAAAAGGCCCTCGCTTTATTGCGGAAGTTAGGGTCACTGAACTTTT
 
. : . : . : . : . : . :
JMFN019E05+ TGAAAGCTTTGTGAAAGCATTCATCTGAAAGTTGTAAAATGATCTTGCAACAGTCTCTTT
JMFN043O09+ GAAAGTTGTAAAATGATCTGCAACCAGTCTCTTT
                      ____________________________________________________________
consensus TGAAAGCTTTGTGAAAGCATTCATCTGAAAGTTGTAAAATGATCTTGCACCAGTCTCTTT
 
. : . : . : . : . : . :
JMFN019E05+ TTATGAGGATTTGATTCCCAGAAGCAGACTGTTTCAGGTCTTCTACGCATACGTCGTCTC
JMFN043O09+ TTATGAGGATTTGATTCCCAGAAGCAGACTGTTTCAGGTCTTCTACGCATACGTCGTCTC
                      ____________________________________________________________
consensus TTATGAGGATTTGATTCCCAGAAGCAGACTGTTTCAGGTCTTCTACGCATACGTCGTCTC
 
. : . : . : . : . : . :
JMFN019E05+ CCTTTACCAGTGCCATCGAGCAGTCACTTGTTTGGTTTGTAGAGACGGGCGGCGGTATTG
JMFN043O09+ CCTTTACCAGTGCCATCGAGCAGTCACTTGTTTGGTTTGTAGAGACGGGCGGCGGTATTG
                      ____________________________________________________________
consensus CCTTTACCAGTGCCATCGAGCAGTCACTTGTTTGGTTTGTAGAGACGGGCGGCGGTATTG
 
. : . : . : . : . : . :
JMFN019E05+ GAGGCTCGCTATTCCCTGGAGGTGGTGATGCCGGCAGCGATGGCTTTAGTGGGCTGTCTT
JMFN043O09+ GAGGCTCGCTATTCCCTGGAGGTGGTGATGCCGGCAGCGATGGCTTTAGTGGGCTGTCTT
                      ____________________________________________________________
consensus GAGGCTCGCTATTCCCTGGAGGTGGTGATGCCGGCAGCGATGGCTTTAGTGGGCTGTCTT
 
. : . : . : . : . : . :
JMFN019E05+ CAACTGCTGCCGATGGTGACGGTGGCAGTATCGGCAGCGATGGCTTTAGTGGGCTGTCTT
JMFN043O09+ CAACTGCTGCCGATGGTGACGGTGGCAGTATCGGCAGCGATGGCTTTAGTGGGCTGTCTT
                      ____________________________________________________________
consensus CAACTGCTGCCGATGGTGACGGTGGCAGTATCGGCAGCGATGGCTTTAGTGGGCTGTCTT
 
. : . : . : . : . : . :
JMFN019E05+ CAACTGCTGCCGATGGTGACGGTGGCAGTATCGGCTTTACAGTAATGGTTTCCGTTGGAG
JMFN043O09+ CAACTGCTGCCGATGGTGACGGTGGCAGTATCGGCTTTACAGTAATGGTTTCCGTTGGAG
                      ____________________________________________________________
consensus CAACTGCTGCCGATGGTGACGGTGGCAGTATCGGCTTTACAGTAATGGTTTCCGTTGGAG
 
. : . : . : . : . : . :
JMFN019E05+ GTGGATGGCTATGGGGTTGGCGAAGGCGGTACTGGTTGCTAGTATGTTTGTGGTTCCTGG
JMFN043O09+ GTGGGTGGCTATGGGGTTGGCGAAGGCGGTACTGGTTGCTAGTATGTTTGTGGTTCCTGG
                      ____________________________________________________________
consensus GTGGGTGGCTATGGGGTTGGCGAAGGCGGTACTGGTTGCTAGTATGTTTGTGGTTCCTGG
 
. : . : . : . : . : . :
JMFN019E05+ TTGCGGAGCGCAGTGGTGGATGCCGGTGGCGGTGGTTCCTGGTTGCGGAGGGTAGCGGTG
JMFN043O09+ TTGCGGAGCGCAGTGGTGGATGCCGGTGGCGGTGGTTCCTGGTTGCGGAGGGTAGCGGTG
JMFN003C18+ AGGGTAACGGTG
                      ____________________________________________________________
consensus TTGCGGAGCGCAGTGGTGGATGCCGGTGGCGGTGGTTCCTGGTTGCGGAGGGTAGCGGTG
 
. : . : . : . : . : . :
JMFN019E05+ GTATTGACGGTGGATGCTGGTGGTTCCTGGGTGCGGAACGCAGCCGTGGATGC
JMFN043O09+ GTATTGACGGTGGATGCTGGTGGTTCCTGGGTGCGGAACGCAGCCGTGGATGCCCGTGGT
JMFN003C18+ GTATTAACGGTGTATGCTGGTGGTTCCTGGGTCAGGAACGCAGCCGTGTATGCCCGTGGT
                      ____________________________________________________________
consensus GTATTGACGGTGGATGCTGGTGGTTCCTGGGTGCGGAACGCAGCCGTGGATGCCCGTGGT
 
. : . : . : . : . : . :
JMFN043O09+ TCCTGGTTGCGGAGCGCAGCCGTGGATGCCCGTGGTTCCTGGTTGTGGAGCGCAGCCGTG
JMFN003C18+ TCCTGGTTCAGGAGCGCAGCCGTGTATGTCCGTGGTTCCTGGTTGTGGAGCGCAGCCGTG
                      ____________________________________________________________
consensus TCCTGGTTGCGGAGCGCAGCCGTGTATGTCCGTGGTTCCTGGTTGTGGAGCGCAGCCGTG
 
. : . : . : . : . : . :
JMFN043O09+ GATGCTGGTGATTCTTGGTGGCGGAGCTCAGCCGTGGATGCCGGTGGTTCCTGGTTGCG
JMFN003C18+ GATGCTGGTGATTCTTGGTGCCGGAGCTCAGCCGTGGATGCCGGTGGTTCCTGGTTGCGG
                      ____________________________________________________________
consensus GATGCTGGTGATTCTTGGTGGCGGAGCTCAGCCGTGGATGCCGGTGGTTCCTGGTTGCGG
 
. : . : . : . : . : . :
JMFN003C18+ AGCTCAGCGGTGTATGCCGGTGGTTCCTGGTTGCGGAGCTCAGCGGTGGATGCCGGTGGT
                      ____________________________________________________________
consensus AGCTCAGCGGTGTATGCCGGTGGTTCCTGGTTGCGGAGCTCAGCGGTGGATGCCGGTGGT
 
. : . : . : . : . : . :
JMFN003C18+ TCCTGGAATGGTGGTGCCGGCGTGAAACTGATGGTGAATGGTGATGCCGGTGTGAATCTG
                      ____________________________________________________________
consensus TCCTGGAATGGTGGTGCCGGCGTGAAACTGATGGTGAATGGTGATGCCGGTGTGAATCTG
 
. : . : . : . : . : . :
JMFN003C18+ ATGGTGAATGGTGATGCCGGTGATGATGATGGTGCGACGGTGGTGGCGAAGGTTGTAGGT
                      ____________________________________________________________
consensus ATGGTGAATGGTGATGCCGGTGATGATGATGGTGCGACGGTGGTGGCGAAGGTTGTAGGT
 
. : . : . : . : . : . :
JMFN003C18+ ACCCGACCGGGAATGTAGCTGGCTCGCCGAATTGCGGAAGAGGCGGTTGGAACCATGGAG
                      ____________________________________________________________
consensus ACCCGACCGGGAATGTAGCTGGCTCGCCGAATTGCGGAAGAGGCGGTTGGAACCATGGAG
 
. : . : . : . : . : . :
JMFN003C18+ GTTGGGGACTTAAGTTCCAGGGAGGAAAGTCAGGAAACAATGGAAGCAAAGGAACACCTG
                      ____________________________________________________________
consensus GTTGGGGACTTAAGTTCCAGGGAGGAAAGTCAGGAAACAATGGAAGCAAAGGAACACCTG
 
. : . : . : . : . : . :
JMFN003C18+ GACACCTCATAATTATACACCACCATGCTGTGGTTTTTTGCTGCGCTGGAGACTGATCGG
                      ____________________________________________________________
consensus GACACCTCATAATTATACACCACCATGCTGTGGTTTTTTGCTGCGCTGGAGACTGATCGG
 
. : . : . : . : . : . :
JMFN003C18+ CGAAAGCCACCGCCGCGCAAAGTGCAAAGAACAAGGAGAAGAGGAGTGTGTGGAGAGTAG
                      ____________________________________________________________
consensus CGAAAGCCACCGCCGCGCAAAGTGCAAAGAACAAGGAGAAGAGGAGTGTGTGGAGAGTAG