Previous Contig 002242:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN003C02Sequence505002242 (2)gb:AY552546_16134006e-20Ipomoea batatas Kunitz-type trypsin inhibitor mRNA, complete cds.
JMFN046K22Sequence534002242 (2)gb:AY552546_16134006e-18Ipomoea batatas Kunitz-type trypsin inhibitor mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN046K22+ AGTGAAGA
                      ____________________________________________________________
consensus AGTGAAGA
 
. : . : . : . : . : . :
JMFN046K22+ ATAAACTGCGCAATCGAATCGAATGGAAGATAATTCAATGAATGATGATTGTTTGATTAT
JMFN003C02+ CAATGAATGATGATTGTTTGATTAT
                      ____________________________________________________________
consensus ATAAACTGCGCAATCGAATCGAATGGAAGATAATTCAATGAATGATGATTGTTTGATTAT
 
. : . : . : . : . : . :
JMFN046K22+ TTTTATTGAAAGGAATGTGTTTCAAAGCGTTGATAAAGCAACATTTTCAAAATATGAAAA
JMFN003C02+ TTTTATTGAAAGGAATGTGTTTCAAAGCGTTGATAAAGCAACATTTTCAAAATATGAAAA
                      ____________________________________________________________
consensus TTTTATTGAAAGGAATGTGTTTCAAAGCGTTGATAAAGCAACATTTTCAAAATATGAAAA
 
. : . : . : . : . : . :
JMFN046K22+ TGTGAGGCGTGGACAATTGTAAAATGAAGACATTTATTTATAAATATAACTTATTAGGAC
JMFN003C02+ TGTGAGGCGTGGACAATTGTAAAATGAAGACATTTATTTATAAATATAACTTATTAGGAC
                      ____________________________________________________________
consensus TGTGAGGCGTGGACAATTGTAAAATGAAGACATTTATTTATAAATATAACTTATTAGGAC
 
. : . : . : . : . : . :
JMFN046K22+ ATTCATATTTTTATATATTGAATTTTAGTATATTGACCCGACTGGATATGAATTCTGACT
JMFN003C02+ ATTCATATTTTTATATATTGAATTTTAGTATATTGACCCGACTGGATATGAATTCTGACT
                      ____________________________________________________________
consensus ATTCATATTTTTATATATTGAATTTTAGTATATTGACCCGACTGGATATGAATTCTGACT
 
. : . : . : . : . : . :
JMFN046K22+ TTGCCAAAAGCAGAGAAGACTGATCCACATCTGGCTCTATAGGTAGATGAATTAGCAAGG
JMFN003C02+ TTGCCAAAAGCAGAGAAGACTGATCCACATCTGGCTCTATAGGTAGATGAATTAGCAAGG
                      ____________________________________________________________
consensus TTGCCAAAAGCAGAGAAGACTGATCCACATCTGGCTCTATAGGTAGATGAATTAGCAAGG
 
. : . : . : . : . : . :
JMFN046K22+ CCTAATGCAGTAGCAGCGGCGCGTGATCCCTTTGCAGTCGCCCTCGGGGAACCCCTCCCC
JMFN003C02+ CCTAATGCAGTAGCAGCGGCGCGTGATCCCTTTGCAGTCGCCCTCGGGGAACCCCTCCCC
                      ____________________________________________________________
consensus CCTAATGCAGTAGCAGCGGCGCGTGATCCCTTTGCAGTCGCCCTCGGGGAACCCCTCCCC
 
. : . : . : . : . : . :
JMFN046K22+ CTTGCAAGCCGCTACGCATTTTCCGACCTCATCACATGGCTCCTTGAACTTGGAGCTCGG
JMFN003C02+ CTTGCAAGCCGCTACGCATTTTCCGACCTCATCACATGGCTCCTTGAACTTGGAGCTCGG
                      ____________________________________________________________
consensus CTTGCAAGCCGCTACGCATTTTCCGACCTCATCACATGGCTCCTTGAACTTGGAGCTCGG
 
. : . : . : . : . : . :
JMFN046K22+ GATCGGGCATTTCTTCGCCTCCGTCACCATTATTGTAGTGTTTGTTCCCATCTCAGTGGC
JMFN003C02+ GATCGGGCATTTCTTCGCCTCCGTCACCATTATTGTAGTGTTTGTTCCCATCTCAGTGGC
                      ____________________________________________________________
consensus GATCGGGCATTTCTTCGCCTCCGTCACCATTATTGTAGTGTTTGTTCCCATCTCAGTGGC
 
. : . : . : . : . : . :
JMFN046K22+ CATGATCATTATCACAAAGAGAAGGACGTCTGTAAAGGAACGGAGA
JMFN003C02+ CATGATCATTATCACAAAGAGAAGGACGTCTGTAAAGGAACGGAGAGATGAAGCCATGTT
                      ____________________________________________________________
consensus CATGATCATTATCACAAAGAGAAGGACGTCTGTAAAGGAACGGAGAGATGAAGCCATGTT