Previous Contig 002241:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN003B02Sequence641002241 (2)pir|S40404|S404044e-65superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat
JMFN008G16Sequence642002241 (2)pir|S40404|S404044e-65superoxide dismutase (EC 1.15.1.1) (Cu-Zn) - sweet potato>gb:IBSOD_1682969 I.bat

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN008G16+ ATGAAAGTTGGTCAAAAAAGCTTACAAACATATTTATCAATA
                      ____________________________________________________________
consensus ATGAAAGTTGGTCAAAAAAGCTTACAAACATATTTATCAATA
 
. : . : . : . : . : . :
JMFN008G16+ TTGATGAATCCTTCATTGTTTCATTTCCTCTGTCTGCTAGAAGCTGAGTTTTCACATCTA
JMFN003B02+ TA
                      ____________________________________________________________
consensus TTGATGAATCCTTCATTGTTTCATTTCCTCTGTCTGCTAGAAGCTGAGTTTTCACATCTA
 
. : . : . : . : . : . :
JMFN008G16+ ACCCTGCAGACCAATGATACCACAAGCAACTCTGCCACCAGCATTTCAAGTGCTTTTACT
JMFN003B02+ ACCCTGCAGACCAATGATACCACAAGCAACTCTGCCACCAGCATTTCAAGTGCTTTTACT
                      ____________________________________________________________
consensus ACCCTGCAGACCAATGATACCACAAGCAACTCTGCCACCAGCATTTCAAGTGCTTTTACT
 
. : . : . : . : . : . :
JMFN008G16+ GAGCTCATGACCACCTTTACCAAGATCATCAGGATCAGCATGGACAACTACAGATCTTCC
JMFN003B02+ GAGCTCATGACCACCTTTACCAAGATCATCAGGATCAGCATGGACAACTACAGATCTTCC
                      ____________________________________________________________
consensus GAGCTCATGACCACCTTTACCAAGATCATCAGGATCAGCATGGACAACTACAGATCTTCC
 
. : . : . : . : . : . :
JMFN008G16+ AATGATAGAATGTGCTCCAGTAAGAGGAATCTGCTTGTCAGTGATGGTGAAAGAAGCAGT
JMFN003B02+ AATGATAGAATGTGCTCCAGTAAGAGGAATCTGCTTGTCAGTGATGGTGAAAGAAGCAGT
                      ____________________________________________________________
consensus AATGATAGAATGTGCTCCAGTAAGAGGAATCTGCTTGTCAGTGATGGTGAAAGAAGCAGT
 
. : . : . : . : . : . :
JMFN008G16+ TCCATCTTCTCCAACTGTGATGTTACCAAGATCACCCACATGGCGGTTCTCATCGTCAGG
JMFN003B02+ TCCATCTTCTCCAACTGTGATGTTACCAAGATCACCCACATGGCGGTTCTCATCGTCAGG
                      ____________________________________________________________
consensus TCCATCTTCTCCAACTGTGATGTTACCAAGATCACCCACATGGCGGTTCTCATCGTCAGG
 
. : . : . : . : . : . :
JMFN008G16+ GGCACCATGCTCCTTGCCAGCAGGATTGAAATGGGGTCCAGTTGACATGCAGCCATTTGT
JMFN003B02+ GGCACCATGCTCCTTGCCAGCAGGATTGAAATGGGGTCCAGTTGACATGCAGCCATTTGT
                      ____________________________________________________________
consensus GGCACCATGCTCCTTGCCAGCAGGATTGAAATGGGGTCCAGTTGACATGCAGCCATTTGT
 
. : . : . : . : . : . :
JMFN008G16+ TGTACCACCTAGGGCATGAACATGGAAGCCATGAAGTCCAGGTTTGAGGCCTGAAATGTT
JMFN003B02+ TGTACCACCTAGGGCATGAACATGGAAGCCATGAAGTCCAGGTTTGAGGCCTGAAATGTT
                      ____________________________________________________________
consensus TGTACCACCTAGGGCATGAACATGGAAGCCATGAAGTCCAGGTTTGAGGCCTGAAATGTT
 
. : . : . : . : . : . :
JMFN008G16+ TCCAGTAACTGTAGTTGGGCTCGGGGCTCTGGATATCAAGCTCTCATTTTGAACCACATA
JMFN003B02+ TCCAGTAACTGTAGTTGGGCTCGGGGCTCTGGATATCAAGCTCTCATTTTGAACCACATA
                      ____________________________________________________________
consensus TCCAGTAACTGTAGTTGGGCTCGGGGCTCTGGATATCAAGCTCTCATTTTGAACCACATA
 
. : . : . : . : . : . :
JMFN008G16+ CCCTATTATTTTATAGATAAATAGCTTGATGTATGCATGTTACATTAACAGTCTTTACAT
JMFN003B02+ CCCTATTATTTTATAGATAAATAGCTTGATGTATGCATGTTACATTAACAGTCTTTACAT
                      ____________________________________________________________
consensus CCCTATTATTTTATAGATAAATAGCTTGATGTATGCATGTTACATTAACAGTCTTTACAT
 
. : . : . : . : . : . :
JMFN008G16+ TTCTTTAACTACCTTCTGATGTTTAGCCTTCATCTTCTGAATCAATTATTTTTGAAATTG
JMFN003B02+ TTCTTTAACTACCTTCTGATGTTTAGCCTTCATCTTCTGAATCAATTATTTTTGAAATTG
                      ____________________________________________________________
consensus TTCTTTAACTACCTTCTGATGTTTAGCCTTCATCTTCTGAATCAATTATTTTTGAAATTG