Previous Contig 002239:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012E07Sequence490002239 (10)gb:AJ843122_18145073e-54Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).675002239 (10)sp|Q40585|VATL_TOBAC3e-51Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF040G01Sequence486002239 (10)gb:AJ843122_18145071e-39Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).715002239 (10)sp|Q40585|VATL_TOBAC6e-43Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF049L20Sequence614002239 (10)gb:AJ843122_18145071e-56Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).
JMFN003A18Sequence627002239 (10)sp|Q40585|VATL_TOBAC2e-58Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFN004B15Sequence627002239 (10)sp|Q40585|VATL_TOBAC2e-58Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFN017A20Sequence610002239 (10)sp|Q40585|VATL_TOBAC2e-58Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFN019H03Sequence359002239 (10)sp|Q40585|VATL_TOBAC8e-28Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFN035G07Sequence623002239 (10)sp|Q40585|VATL_TOBAC2e-58Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF040G01- TNNTTATAGTAACA
                      ____________________________________________________________
consensus TNNTTATAGTAACA
 
. : . : . : . : . : . :
rJMFF040G01- CTGAACAGGTTCATACACCACCATGCATTCATGCAATGAGTAAAATAAAGTAGGAATCAA
                      ____________________________________________________________
consensus CTGAACAGGTTCATACACCACCATGCATTCATGCAATGAGTAAAATAAAGTAGGAATCAA
 
. : . : . : . : . : . :
rJMFF040G01- ATAAATATCATAGGTGTACAGATCAGAGCTCAAAAGGGGGGAAAAAGGGTTGTACATAAT
rJMFF012E07- ATCATAGGTGTACAGATCAGAGCTCAAAAGGGGGGAAAAAGGGTTGTACATAAT
                      ____________________________________________________________
consensus ATAAATATCATAGGTGTACAGATCAGAGCTCAAAAGGGGGGAAAAAGGGTTGTACATAAT
 
. : . : . : . : . : . :
rJMFF040G01- TCAGAAACGATATATAATAACCCAAAAGTACTCGCTAAAGGGAAAAGACCAGTGACTGGC
rJMFF012E07- TCAGAAACGATATATAATAACCCAAAAGTACTCGCTAAAGGGAAAAGACCAGTGACTGGC
                      ____________________________________________________________
consensus TCAGAAACGATATATAATAACCCAAAAGTACTCGCTAAAGGGAAAAGACCAGTGACTGGC
 
. : . : . : . : . : . :
rJMFF040G01- TTCATAATTAAGCTTATTCCTTATGACTCTTAATAGTGCCAGAATGAAGAACGACAACAA
rJMFF012E07- TTCATAATTAAGCTTATTCCTTATGACTCTTAATAGTGCCAGAATGAAGAACGACAACAA
JMFN035G07+ CCAGAATGAAGAACGACAACAA
JMFN004B15+ CCAGAATGAAGAACGACAACAA
                      ____________________________________________________________
consensus TTCATAATTAAGCTTATTCCTTATGACTCTTAATAGTGCCAGAATGAAGAACGACAACAA
 
. : . : . : . : . : . :
rJMFF040G01- ACCTCAATAGCTTCTCGTACGTGCTTCATAAAAATTGACTTTCTACCACAGCCTTCTAAG
rJMFF012E07- ACCTCAATAGCTTCTCGTACGTGCTTCATAAAAATTGACTTTCTACCACAGCCTTCTAAG
JMFN035G07+ ACCTCAATAGCTTCTCGTACGTGCTTCATAAAAATTGACTTTCTACCACAGCCTTCTAAG
JMFN019H03+ TCGTACGTGCTTCATAAAAATTGACTTTCTACCACAGCCTTCTAAG
JMFN004B15+ ACCTCAATAGCTTCTCGTACGTGCTTCATAAAAATTGACTTTCTACCACAGCCTTCTAAG
JMFN017A20+ AGCCTTTTAAG
JMFN003A18+ ATTGACTTTCTACCACAGCCTTCTAAG
                      ____________________________________________________________
consensus ACCTCAATAGCTTCTCGTACGTGCTTCATAAAAATTGACTTTCTACCACAGCCTTCTAAG
 
. : . : . : . : . : . :
rJMFF040G01- GACATAAATCATATCCTCCTTTTTACTCTGCTCTAGACTGCCCAGCTCGAGAAGACAAGA
rJMFF012E07- GACATAAATCATATCCTCCTTTTTACTCTGCTCTAGACTGCCCAGCTCGAGAAGACAAGA
JMFN035G07+ GACATAAATCATATCCTCCTTTTTACTCTGCTCTAGACTGCCCAGCTCGAGAAGACAAGA
JMFN019H03+ GACATAAATCATATCCTCCTTTTTACTCTGCTCTAGACTGCCCAGCTCGAGAAGACAAGA
JMFN004B15+ GACATAAATCATATCCTCCTTTTTACTCTGCTCTAGACTGCCCAGCTCGAGAAGACAAGA
JMFN017A20+ GACATAAATCATATCCTCCTTTTTACTCTGCTCTAGACTGCCCAGCTCGAGAAGACAAGA
JMFF049L20+ TAGACTGCCCAGCTCGAGAAGACAAGA
JMFN003A18+ GACATAAATCATATCCTCCTTTTTACTCTGCTCTAGACTGCCCAGCTCGAGAAGACAAGA
                      ____________________________________________________________
consensus GACATAAATCATATCCTCCTTTTTACTCTGCTCTAGACTGCCCAGCTCGAGAAGACAAGA
 
. : . : . : . : . : . :
rJMFF040G01- TAATGCCGACGATGAGACCATAAAGGGCCAAAGCTTCAGCAAAAATGAGAATAAGGATCA
rJMFF012E07- TAATGCCGACGATGAGACCATAAAGGGCCAAAGCTTCAGCAAAAATGAGAATAAGGATCA
JMFN035G07+ TAATGCCGACGATGAGACCATAAAGGGCCAAAGCTTCAGCAAAAATGAGAATAAGGATCA
JMFN019H03+ TAATGCCGACGATGAGACCATAAAGGGCCAAAGCTTCAGCAAAAATGAGAATAAGGATCA
JMFN004B15+ TAATGCCGACGATGAGACCATAAAGGGCCAAAGCTTCAGCAAAAATGAGAATAAGGATCA
JMFN017A20+ TAATGCCGACGATGAGACCATAAAGGGCCAAAGCTTCAGCAAAAATGAGAATAAGGATCA
JMFF049L20+ TAATGCCGACGATGAGACCATAAAGGGCCAAAGCTTCAGCAAAAATGAGAATAAGGATCA
JMFF012E07+ GCCAAAGCTTCAGCAAAAATGAGAATAAGGATCA
JMFN003A18+ TAATGCCGACGATGAGACCATAAAGGGCCAAAGCTTCAGCAAAAATGAGAATAAGGATCA
                      ____________________________________________________________
consensus TAATGCCGACGATGAGACCATAAAGGGCCAAAGCTTCAGCAAAAATGAGAATAAGGATCA
 
. : . : . : . : . : . :
rJMFF040G01- TTCCAACAAAAAGTTTTGGCTGCTGTGCATTAGCCCTGACACCGGCATCGCCAACGATTC
rJMFF012E07- TTCCAACAAAAAGTTTTGGCTGCTGTGCATTAGCCCTGACACCGGCATCGCCAACGATTC
JMFN035G07+ TTCCAACAAAAAGTTTTGGCTGCTGTGCATTAGCCCTGACACCGGCATCGCCAACGATTC
JMFN019H03+ TTCCAACAAAAAGTTTTGGCTGCTGTGCATTAGCCCTGACACCGGCATCGCCAACGATTC
JMFN004B15+ TTCCAACAAAAAGTTTTGGCTGCTGTGCATTAGCCCTGACACCGGCATCGCCAACGATTC
JMFN017A20+ TTCCAACAAAAAGTTTTGGCTGCTGTGCATTAGCCCTGACACCGGCATCGCCAACGATTC
JMFF049L20+ TTCCAACAAAAAGTTTTGGCTGCTGTGCATTAGCCCTGACACCGGCATCGCCAACGATTC
JMFF040G01+ CCGGCATCGCCAACGATTC
JMFF012E07+ TTCCAACAAAAAGTTTTGGCTGCTGTGCATTAGCCCTGACACCGGCATCGCCAACGATTC
JMFN003A18+ TTCCAACAAAAAGTTTTGGCTGCTGTGCATTAGCCCTGACACCGGCATCGCCAACGATTC
                      ____________________________________________________________
consensus TTCCAACAAAAAGTTTTGGCTGCTGTGCATTAGCCCTGACACCGGCATCGCCAACGATTC
 
. : . : . : . : . : . :
rJMFF040G01- CGATGGCCATTCCGGCAGAGAGTCCGGCGAGGCCACAAGCGAGACCGGAAGAGAGATGTG
rJMFF012E07- CGATGGCCATTCCGGCAGAGAGTCCGGCGAGGCCACAAGCGAGACCGGAAGAGAGATGTG
JMFN035G07+ CGATGGCCATTCCGGCAGAGAGTCCGGCGAGGCCACAAGCGAGACCGGAAGAGAGATGTG
JMFN019H03+ CGATGGCCATTCCGGCAGAGAGTCCGGCGAGGCCACAAGCGAGACCGGAAGAGAGATGTG
JMFN004B15+ CGATGGCCATTCCGGCAGAGAGTCCGGCGAGGCCACAAGCGAGACCGGAAGAGAGATGTG
JMFN017A20+ CGATGGCCATTCCGGCAGAGAGTCCGGCGAGGCCACAAGCGAGACCGGAAGAGAGATGTG
JMFF049L20+ CGATGGCCATTCCGGCAGAGAGTCCGGCGAGGCCACAAGCGAGACCGGAAGAGAGATGTG
JMFF040G01+ CGATGGCCATTCCGGCAGAGAGTCCGGCGAGGCCACAAGCGAGACCGGAAGAGAGATGTG
JMFF012E07+ CGATGGCCATTCCGGCAGAGAGTCCGGCGAGGCCACAAGCGAGACCGGAAGAGAGATGTG
JMFN003A18+ CGATGGCCATTCCGGCAGAGAGTCCGGCGAGGCCACAAGCGAGACCGGAAGAGAGATGTG
                      ____________________________________________________________
consensus CGATGGCCATTCCGGCAGAGAGTCCGGCGAGGCCACAAGCGAGACCGGAAGAGAGATGTG
 
. : . : . : . : . : . :
rJMFF040G01- CATATCCATCGAATAGGTAGTAAGACTTGGTTTTGGGGTTAATCCCAGTACTGATGATCA
rJMFF012E07- CATATCCATCGAATAGGTAGTAAGACTTGGTTTTGGGGTTAATCCCAGTACTGATGATCA
JMFN035G07+ CATATCCATCGAATAGGTAGTAAGACTTGGTTTTGGGGTTAATCCCAGTACTGATGATCA
JMFN019H03+ CATATCCATCGAATAGGTAGTAAGACTTGGTTTTGGGGTTAATCCCAGTACTGATGATCA
JMFN004B15+ CATATCCATCGAATAGGTAGTAAGACTTGGTTTTGGGGTTAATCCCAGTACTGATGATCA
JMFN017A20+ CATATCCATCGAATAGGTAGTAAGACTTGGTTTTGGGGTTAATCCCAGTACTGATGATCA
JMFF049L20+ CATATCCATCGAATAGGTAGTAAGACTTGGTTTTGGGGTTAATCCCAGTACTGATGATCA
JMFF040G01+ CATATCCATCGAATAGGTAGTAAGACTTGGTTTTGGGGTTAATCCCAGTACTGATGATCA
JMFF012E07+ CATATCCATCGAATAGGTAGTAAGACTTGGTTTTGGGGTTAATCCCAGTACTGATGATCA
JMFN003A18+ CATATCCATCGAATAGGTAGTAAGACTTGGTTTTGGGGTTAATCCCAGTACTGATGATCA
                      ____________________________________________________________
consensus CATATCCATCGAATAGGTAGTAAGACTTGGTTTTGGGGTTAATCCCAGTACTGATGATCA
 
. : . : . : . : . : . :
rJMFF040G01- CAGCAATAATCAATCCGTAAATACCAAGCACACCAGCCATAACCACCGGCACGATCGACT
rJMFF012E07- CAGCAATAATCAATCCGTAAATACCAAGCACACCAGCCATAACCACCGGCACGATCGACT
JMFN035G07+ CAGCAATAATCAATCCGTAAATACCAAGCACACCAGCCATAACCACCGGCACGATCGACT
JMFN019H03+ CAGCAATAATCAA
JMFN004B15+ CAGCAATAATCAATCCGTAAATACCAAGCACACCAGCCATAACCACCGGCACGATCGACT
JMFN017A20+ CAGCAATAATCAATCCGTAAATACCAAGCACACCAGCCATAACCACCGGCACGATCGACT
JMFF049L20+ CAGCAATAATCAATCCGTAAATACCAAGCACACCAGCCATAACCACCGGCACGATCGACT
JMFF040G01+ CAGCAATAATCAATCCGTAAATACCAAGCACACCAGCCATAACCACCGGCACGATCGACT
JMFF012E07+ CAGCAATAATCAATCCGTAAATACCAAGCACACCAGCCATAACCACCGGCACGATCGACT
JMFN003A18+ CAGCAATAATCAATCCGTAAATACCAAGCACACCAGCCATAACCACCGGCACGATCGACT
                      ____________________________________________________________
consensus CAGCAATAATCAATCCGTAAATACCAAGCACACCAGCCATAACCACCGGCACGATCGACT
 
. : . : . : . : . : . :
rJMFF040G01- TCATCACAAGCTCCGGNCTCATCACTCCCATCGACGCCACT
rJMFF012E07- TCATCACAAGCTCCGGCCTCATCACTCCCATCGACGCCACTCCGACGCCACTCTTCGCCG
JMFN035G07+ TCATCACAAGCTCCGGCCTCATCACTCCCATCGACGCCACTCCGACGCCACTCTTCGCCG
JMFN004B15+ TCATCACAAGCTCCGGCCTCATCACTCCCATCGACGCCACTCCGACGCCACTCTTCGCCG
JMFN017A20+ TCATCACAAGCTCCGGCCTCATCACTCCCATCGACGCCACTCCGACGCCACTCTTCGCCG
JMFF049L20+ TCATCACAAGCTCCGGCCTCATCACTCCCATCGACGCCACTCCGACGCCACTCTTCGCCG
JMFF040G01+ TCATCACAAGCTCCGGCCTCATCACTCCCATCGACGCCACTCCGACGCCACTCTTCGCCG
JMFF012E07+ TCATCACAAGCTCCGGCCTCATCACTCCCATCGACGCCACTCCGACGCCACTCTTCGCCG
JMFN003A18+ TCATCACAAGCTCCGGCCTCATCACTCCCATCGACGCCACTCCGACGCCACTCTTCGCCG
                      ____________________________________________________________
consensus TCATCACAAGCTCCGGCCTCATCACTCCCATCGACGCCACTCCGACGCCACTCTTCGCCG
 
. : . : . : . : . : . :
rJMFF012E07- TTCCATAGGCTGCTCCCATAC
JMFN035G07+ TTCCATAGGCTGCTCCCATACAGGAGAAGACGAGAGCGGCAGCGGCGCCGAGGAAGCCGA
JMFN004B15+ TTCCATAGGCTGCTCCCATACAGGAGAAGACGAGAGCGGCAGCGGCGCCGAGGAAGCCGA
JMFN017A20+ TTCCATAGGCTGCTCCCATACAGGAGAAGACGAGAGCGGCAGCGGCGCCGAGGAAGCCGA
JMFF049L20+ TTCCATAGGCTGCTCCCATACAGGAGAAGACGAGAGCGGCAGCGGCGCCGAGGAAGCCGA
JMFF040G01+ TTCCATAGGCTGCTCCCATACAGGAGAAGACGAGAGCGGCAGCGGCGCCGAGGAAGCCGA
JMFF012E07+ TTCCATAGGCTGCTCCCATACAGGAGAAGACGAGAGCGGCAGCGGCGCCGAGGAAGCCGA
JMFN003A18+ TTCCATAGGCTGCTCCCATACAGGAGAAGACGAGAGCGGCAGCGGCGCCGAGGAAGCCGA
                      ____________________________________________________________
consensus TTCCATAGGCTGCTCCCATACAGGAGAAGACGAGAGCGGCAGCGGCGCCGAGGAAGCCGA
 
. : . : . : . : . : . :
JMFN035G07+ AGAAGGGAGCAGTTTCATCGCCGCTGAAAGTCGAAGACATTGTTCGGATCTTTTGATGGG
JMFN004B15+ AGAAGGGAGCAGTTTCATCGCCGCTGAAAGTCGAAGACATTGTTCGGATCTTTTGATGGG
JMFN017A20+ AGAAGGGAGCAGTTTCATCGCCGCTGAAAGTCGAAGACATTGTTCGGATCTTTTGATGGG
JMFF049L20+ AGAAGGGAGCAGTTTCATCGCCGCTGAAAGTCGAAGACATTGTTCGGATCTTTTGATGGG
JMFF040G01+ AGAAGGGAGCAGTTTCATCGTCGCTGAAAGTCGAAGACATTGTTCGGATCTTTTGATGGG
JMFF012E07+ AGAAGGGAGCAGTTTCATCGCCGCTGAAAGTCGAAGACATTGTTCGGATCTTTTGATGGG
JMFN003A18+ AGAAGGGAGCAGTTTCATCGCCGCTGAAAGTCGAAGACATTGTTCGGATCTTTTGATGGG
                      ____________________________________________________________
consensus AGAAGGGAGCAGTTTCATCGCCGCTGAAAGTCGAAGACATTGTTCGGATCTTTTGATGGG
 
. : . : . : . : . : . :
JMFN035G07+ A
JMFN004B15+ ATTTG
JMFN017A20+ ATTTGGGATCTGAGATTTAGCGTCTGAACTCTGAACAGAGAGAGAGGTCTTGAGTTTTG
JMFF049L20+ ATTTGGGATCTGAGATT
JMFF040G01+ ATTTGGGATCTGAGATT
JMFF012E07+ ATTTGGGATCTGAGATTTAGCGTCTGAACTCTGAAC
JMFN003A18+ ATTTGGGATCTGAGATTTAGCGTCTGAACTCTGAACAGAGAGAGAGGTCTTGAGTTTTGG
                      ____________________________________________________________
consensus ATTTGGGATCTGAGATTTAGCGTCTGAACTCTGAACAGAGAGAGAGGTCTTGAGTTTTGG