Previous Contig 002234:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN001H09Sequence476002234 (3)gb:AB030083_15183989e-62Populus nigra PnLPK mRNA for lectin-like protein kinase, complete cds.
JMFN011E06Sequence612002234 (3)gb:AB030083_15183988e-43Populus nigra PnLPK mRNA for lectin-like protein kinase, complete cds.
JMSF033N15Sequence732002234 (3)gb:AB030083_15183981e-76Populus nigra PnLPK mRNA for lectin-like protein kinase, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN011E06+ CATTTCAAGAATTTAAACTATACAAGTATATAAAGAATT
                      ____________________________________________________________
consensus CATTTCAAGAATTTAAACTATACAAGTATATAAAGAATT
 
. : . : . : . : . : . :
JMFN011E06+ TCAGCTTCCCGAGGGCAACCCAACCAAGTTGGTTGGACTATTGACTTTGTAACCATAAGA
rJMSF033N15- ACCATAAGA
                      ____________________________________________________________
consensus TCAGCTTCCCGAGGGCAACCCAACCAAGTTGGTTGGACTATTGACTTTGTAACCATAAGA
 
. : . : . : . : . : . :
JMFN011E06+ TTACAATTACAA-GTTCGACTCCGAGGAGCTGGCTAACTATGGACAACTTAGGCTGGTTT
rJMSF033N15- TTACAATTACAAGGTTCGACTCCGAGGAGCTGGCTAACTATGGACAACTTAGGCTGGTTT
                      ____________________________________________________________
consensus TTACAATTACAAGGTTCGACTCCGAGGAGCTGGCTAACTATGGACAACTTAGGCTGGTTT
 
. : . : . : . : . : . :
JMFN011E06+ ACTACAAATTTAACTATACCGAGGAGTTTGTGTGCCCTGTATCGATCTGGCTCCAACCCG
rJMSF033N15- ACTACAAATTTAACTATACCGAGGAGTTTGTGTGCCCTGTATCGATCTGGCTCCAACCCG
                      ____________________________________________________________
consensus ACTACAAATTTAACTATACCGAGGAGTTTGTGTGCCCTGTATCGATCTGGCTCCAACCCG
 
. : . : . : . : . : . :
JMFN011E06+ AGTTGAAGGGGGAAATTGGGATAGATGTTGTTGTATCAGTTTGAGATGAATCTATATCAA
rJMSF033N15- AGTTGAAGGGGGAAATTGGGATAGATGTTGTTGTATCAGTTTGAGATGAATCTATATCAA
                      ____________________________________________________________
consensus AGTTGAAGGGGGAAATTGGGATAGATGTTGTTGTATCAGTTTGAGATGAATCTATATCAA
 
. : . : . : . : . : . :
JMFN011E06+ TGGGCAGTGCTGATGGCCACACAAATGCAGGCCTGAATGGAGGAACATTTGGCACTGGAA
rJMSF033N15- TGGGCAGTGCTGATGGCCACACAAATGCAGGCCTGAATGGAGGAACATTTGGCACTGGAA
                      ____________________________________________________________
consensus TGGGCAGTGCTGATGGCCACACAAATGCAGGCCTGAATGGAGGAACATTTGGCACTGGAA
 
. : . : . : . : . : . :
JMFN011E06+ CTGAGCCTAATATGATCTGAACAACATCAGATGTTCTTGGTCTTTCATTAGCAATAGGAT
rJMSF033N15- CTGAGCCTAATATGATCTGAACAACATCAGATGTTCTTGGTCTTTCATTAGCAATAGGAT
                      ____________________________________________________________
consensus CTGAGCCTAATATGATCTGAACAACATCAGATGTTCTTGGTCTTTCATTAGCAATAGGAT
 
. : . : . : . : . : . :
JMFN011E06+ GAGAGCAAGCCAGTCCTAGCAGCAGAAGTCTTTTAGCTTCTTCGACGACGAAATCTTCCT
rJMSF033N15- GAGAGCAAGCCAGTCCTAGCAGCAGAAGTCTTTTAGCTTCTTCGACGACGAAATCTTCCT
                      ____________________________________________________________
consensus GAGAGCAAGCCAGTCCTAGCAGCAGAAGTCTTTTAGCTTCTTCGACGACGAAATCTTCCT
 
. : . : . : . : . : . :
JMFN011E06+ TCAGCCTTATGTCGACTGCCTCGAGGATCCTCCCATCGCGATGCAGGAACCAAACCCAGT
rJMSF033N15- TCAGCCTTATGTCGACTGCCTCGAGGATCCTCCCATCGCGATGCAGGAACCAAACCCAGT
                      ____________________________________________________________
consensus TCAGCCTTATGTCGACTGCCTCGAGGATCCTCCCATCGCGATGCAGGAACCAAACCCAGT
 
. : . : . : . : . : . :
JMFN011E06+ CTACGAGGGACTGGAAGCCGCCAATCCTGGTTCCAGGTCTCTGTCCACACACAACTTCCA
rJMSF033N15- CTACGAGGGACTGGAAGCCGCCAATCCTGGTTCCAGGTCTCTGTCCACACACAACTTCCA
                      ____________________________________________________________
consensus CTACGAGGGACTGGAAGCCGCCAATCCTGGTTCCAGGTCTCTGTCCACACACAACTTCCA
 
. : . : . : . : . : . :
JMFN011E06+ GCAACACTGCCCCGAACGCATAGATATCAGACTG
rJMSF033N15- GCAACACTGCCCCGAACGCATAGATATCAGACTGCTCAGTGGCCTTGCCCGTGAGGAGAC
                      ____________________________________________________________
consensus GCAACACTGCCCCGAACGCATAGATATCAGACTGCTCAGTGGCCTTGCCCGTGAGGAGAC
 
. : . : . : . : . : . :
rJMSF033N15- ACTCGGGTGCAATGTACCCAATTGTGCCCGCCACTCCCTCGCCCTCAGTATACGAGGTTC
                      ____________________________________________________________
consensus ACTCGGGTGCAATGTACCCAATTGTGCCCGCCACTCCCTCGCCCTCAGTATACGAGGTTC
 
. : . : . : . : . : . :
rJMSF033N15- TCTCGTTGTCAAGTGCCCGTGCCAGGCCAAAGTCGCCCAGGCGGGCATTGAAATTGGAGT
JMFN001H09+ GTTGTCAAGTGCCCGTGCCAGGCCAAAGTCGCCCAGGCGGGCATTGAAATTGGAGT
                      ____________________________________________________________
consensus TCTCGTTGTCAAGTGCCCGTGCCAGGCCAAAGTCGCCCAGGCGGGCATTGAAATTGGAGT
 
. : . : . : . : . : . :
rJMSF033N15- CGAGCATGATATTGCTGGCTTTGAGGTCTCGATGAACCACCCTCTGCTCGAACTCGTTAT
JMFN001H09+ CGAGCATGATATTGCTGGCTTTGAGGTCTCGATGAACCACCCTCTGCTCGAACTCGTTAT
                      ____________________________________________________________
consensus CGAGCATGATATTGCTGGCTTTGAGGTCTCGATGAACCACCCTCTGCTCGAACTCGTTAT
 
. : . : . : . : . : . :
rJMSF033N15- GG
JMFN001H09+ GGAGATATTGCAAGGCGTAGCCCACGCCAGACACAATTTTACACCGCAATTCCCAACTCA
                      ____________________________________________________________
consensus GGAGATATTGCAAGGCGTAGCCCACGCCAGACACAATTTTACACCGCAATTCCCAACTCA
 
. : . : . : . : . : . :
JMFN001H09+ ATGGATCCGTTTCACCCCCTATGAAGAGGTGCTGGTCCAAGCTTCCATGGGGCATATACT
                      ____________________________________________________________
consensus ATGGATCCGTTTCACCCCCTATGAAGAGGTGCTGGTCCAAGCTTCCATGGGGCATATACT
 
. : . : . : . : . : . :
JMFN001H09+ CATACACCAATAGTAGCTTCCCATGCCTATGGCACCACCCTAGAAGCTTGACAAGATGTT
                      ____________________________________________________________
consensus CATACACCAATAGTAGCTTCCCATGCCTATGGCACCACCCTAGAAGCTTGACAAGATGTT
 
. : . : . : . : . : . :
JMFN001H09+ TATGGCGGAGACGATTGATAATACTAAGCTCAGCCAAGAAATCACCCTGACCCTTGATGC
                      ____________________________________________________________
consensus TATGGCGGAGACGATTGATAATACTAAGCTCAGCCAAGAAATCACCCTGACCCTTGATGC
 
. : . : . : . : . : . :
JMFN001H09+ TCTCCCTGGAGAACCACTTGACAGCAATCTCCAAACCCTCACCTGCCAACCACCCTTTGT
                      ____________________________________________________________
consensus TCTCCCTGGAGAACCACTTGACAGCAATCTCCAAACCCTCACCTGCCAACCACCCTTTGT
 
. : . : . : . : . : . :
JMFN001H09+ AAACCACCCCATATCCTCCCTGTCCAAGCTTCTTCTTCTCACCAAAATTCTCTGTAGCTT
                      ____________________________________________________________
consensus AAACCACCCCATATCCTCCCTGTCCAAGCTTCTTCTTCTCACCAAAATTCTCTGTAGCTT