Previous Contig 002229:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008N21Sequence548002229 (12)gb:AP001389_18212551e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054521002229 (12)gb:AP001389_18212551e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMFF027B07Sequence538002229 (12)gb:AP001389_18212551e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054511002229 (12)gb:AP001389_18212559e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMFF039B01Sequence496002229 (12)gb:AP001389_18212559e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054459002229 (12)gb:AP001389_18212557e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMFN001D11Sequence492002229 (12)gb:AP001389_18212552e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMFN005A19Sequence501002229 (12)gb:AP001389_18212559e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMFN018P07Sequence507002229 (12)gb:AP001389_18212559e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMFN036H10Sequence501002229 (12)gb:AP001389_18212554e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMFN037I17Sequence585002229 (12)gb:AP001389_18212551e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054
JMSF045P12Sequence496002229 (12)gb:AP001389_18212559e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P054

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN018P07+ GAAGCAAAGGCACTCGATGCAAAACACATGTATACAAAATGTAATAGTAAGA
rJMFF008N21- AAGA
JMFF008N21+ ACAAAATGTAATAGTAAGA
rJMFF027B07- AAGA
JMFF027B07+ ACAAAATGTAATAGTAAGA
JMFN037I17- ACAAAATGTAATAGTAAGA
                      ____________________________________________________________
consensus GAAGCAAAGGCACTCGATGCAAAACACATGTATACAAAATGTAATAGTAAGA
 
. : . : . : . : . : . :
JMFN018P07+ TGCATTGTCTGAATGTTTAAAGCTCATTGCATAAACACAAACCAACAAGCATTTATTATC
rJMFF008N21- CGCATTGTCTGAATGTTTAAAGCTCATTGCATAAACACAAACCAACAAGCATTTATTATC
rJMFF039B01- TTATTATC
JMFF008N21+ CGCATTGTCTGAATGTTTAAAGCTCATTGCATAAACACAAACCAACAAGCATTTATTATC
rJMFF027B07- TGCATTGTCTGAATGTTTAAAGCTCATTGCATAAACACAAACCAACAAGCATTTATTATC
JMFF027B07+ TGCATTGTCTGAATGTTTAAAGCTCATTGCATAAACACAAACCAACAAGCATTTATTATC
JMSF045P12+ TAAACACAAACCAACAAGCATTTATTATC
JMFN005A19+ GCATAAACACAAACCAACAAGCATTTATTATC
JMFF039B01+ AACACAAACCAACAAGCATTTATTATC
JMFN037I17- TGCATTGTCTGAATGTTTAAAGCTCATTGCATAAACACAAACCAACAAGCATTTATTATC
JMFN036H10+ CACAAACCAACAAGCATTTATTATC
JMFN001D11+ GCATTTATTATC
                      ____________________________________________________________
consensus TGCATTGTCTGAATGTTTAAAGCTCATTGCATAAACACAAACCAACAAGCATTTATTATC
 
. : . : . : . : . : . :
JMFN018P07+ ATCTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
rJMFF008N21- ATCTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
rJMFF039B01- ATCTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
JMFF008N21+ ATCTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
rJMFF027B07- ATCTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
JMFF027B07+ ATCTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
JMSF045P12+ ATCTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
JMFN005A19+ ATCTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
JMFF039B01+ ATNTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
JMFN037I17- ATCTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
JMFN036H10+ ATCTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
JMFN001D11+ ATCTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
                      ____________________________________________________________
consensus ATCTACCCCAAAACTGTCTTCTTCATCATCATACAAGATAAAAGCGAAACAAAGGATACC
 
. : . : . : . : . : . :
JMFN018P07+ ATCCGGATCCAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
rJMFF008N21- ATCCGGATCCAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
rJMFF039B01- ATCCGGATCCAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
JMFF008N21+ ATCCGGATCCAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
rJMFF027B07- ATCCGGATCCAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
JMFF027B07+ ATCCGGATCCAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
JMSF045P12+ ATCCGGATCCAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
JMFN005A19+ ATCCGGATCCAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
JMFF039B01+ ATCCGGATCCAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
JMFN037I17- ATCCGGATCCAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
JMFN036H10+ ATCCGGATCCAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
JMFN001D11+ ATCCGGATCGAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
                      ____________________________________________________________
consensus ATCCGGATCCAAAACATTTCATGGTTTGAAGCTTAAAAAGAATTGTTTGTTCTTATGAAG
 
. : . : . : . : . : . :
JMFN018P07+ TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACAATGAA
rJMFF008N21- TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACAATGAA
rJMFF039B01- TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACAATGAA
JMFF008N21+ TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACAATGAA
rJMFF027B07- TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACAATGAA
JMFF027B07+ TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACAATGAA
JMSF045P12+ TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACAATGAA
JMFN005A19+ TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACAATGAA
JMFF039B01+ TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACAATGAA
JMFN037I17- TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACAATGAA
JMFN036H10+ TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACAATGAA
JMFN001D11+ TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACGATGAA
                      ____________________________________________________________
consensus TGACAATGGTAACGTATGGCTGCATGAACTTTGTCAATTGTCAGCCGACTTAACAATGAA
 
. : . : . : . : . : . :
JMFN018P07+ ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
rJMFF008N21- ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
rJMFF039B01- ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
JMFF008N21+ ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
rJMFF027B07- ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
JMFF027B07+ ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
JMSF045P12+ ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
JMFN005A19+ ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
JMFF039B01+ ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
JMFN037I17- ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
JMFN036H10+ ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
JMFN001D11+ ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
                      ____________________________________________________________
consensus ATTTTGGCGGCTGATTGGATTCATAACAACTGGAGGGCCAGCAGTCCGAGGCCATGCCTG
 
. : . : . : . : . : . :
JMFN018P07+ GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTCTGAAACAGTGTGTGGAATTGTACC
rJMFF008N21- GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTCTGAAACAGTGTGTGGAATTGTACC
rJMFF039B01- GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTCTGAAACAGTGTGTGGAATTGTACC
JMFF008N21+ GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTCTGAAACAGTGTGTGGAATTGTACC
rJMFF027B07- GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTCTGAAACAGTGTGTGGAATTGTACC
JMFF027B07+ GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTCTGAAACAGTGTGTGGAATTGTACC
JMSF045P12+ GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTCTGAAACAGTGTGTGGAATTGTACC
JMFN005A19+ GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTCTGAAACAGTGTGTGGAATTGTACC
JMFF039B01+ GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTCTGAAACAGTGTGTGGAATTGTACC
JMFN037I17- GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTCTGAAACAGTGTGTGGAATTGTACC
JMFN036H10+ GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTCTGAAACAGTGTGTGGAATTGTACC
JMFN001D11+ GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTTTGAAACAGTGTGTGGAATTGTACC
                      ____________________________________________________________
consensus GAACTTCTTGTCAGTCTCTTCCCACCAGGCCTTTTCTGAAACAGTGTGTGGAATTGTACC
 
. : . : . : . : . : . :
JMFN018P07+ TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
rJMFF008N21- TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
rJMFF039B01- TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
JMFF008N21+ TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
rJMFF027B07- TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
JMFF027B07+ TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
JMSF045P12+ TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
JMFN005A19+ TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
JMFF039B01+ TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
JMFN037I17- TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
JMFN036H10+ TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
JMFN001D11+ TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
                      ____________________________________________________________
consensus TCCAAAAATCTTCTTGTCAGAAATAATGTGGTCGAAAACATAAGCAACAACAAATGATCC
 
. : . : . : . : . : . :
JMFN018P07+ CGCAAGAGCAGAAATTATTTTAGGACCTGACATTG
rJMFF008N21- CGCAAGAGCAGAAATTATTTTAGGACCTGACATTGCTGAACTCCAATAACGAATGAAGTG
rJMFF039B01- CGCAAGAGCAGAAATTATTTTAGGACCTGACATTGCTGAACTCCAATAACGAATGAAGTG
JMFF008N21+ CGCAAGAGCAGAAATTATTTTAGGACCTGACATTGCTGAACTCCAATAACGAATGAAGTG
rJMFF027B07- CGCAAGAGCAGAAATTATTTTAGGACCTGACATTGCTGAACTCCAATAACGAATGAAGTG
JMFF027B07+ CGCAAGAGCAGAAATTATTTTAGGACCTGACATTGCTGAACTCCAATAACGAATGAAGTG
JMSF045P12+ CGCAAGAGCAGAAATTATTTTAGGACCTGACATTGCTGAACTCCAATAACGAATGAAGTG
JMFN005A19+ CGCAAGAGCAGAAATTATTTTAGGACCTGACATTGCTGAACTCCAATAACGAATGAAGTG
JMFF039B01+ CGCAAGAGCAGAAATTATTTTAGGACCTGACATTGCTGAACTCCAATAACGAATGAAGTG
JMFN037I17- CGCAAGAGCAGAAATTATTTTAGGACCTGACATTGCTGAACTCCAATAACGAATGAAGTG
JMFN036H10+ CGCAAGAGCCGCAATTATTTTAGGACCTGACATTGCTGAACTCCAATAACGAATGAAGTG
JMFN001D11+ CGCAAGAGCAGAAATTATTTTAGGACCTGACATTGTTGAACTCCAATAACGAATGAAGTG
                      ____________________________________________________________
consensus CGCAAGAGCAGAAATTATTTTAGGACCTGACATTGCTGAACTCCAATAACGAATGAAGTG
 
. : . : . : . : . : . :
rJMFF008N21- CAGAGATCTTTGGAGAAAATTCGGAACGACTGCCTTT
rJMFF039B01- CAGAGATCTTTGGAGAAAATTCGGAAC
JMFF008N21+ CAGAGATCTTTGGAGAAAATTCGGAACGACTGCCTTT
rJMFF027B07- CAGAGATCTTTGGAGAAAATTCGGAAC
JMFF027B07+ CAGAGATCTTTGGAGAAAATTCGGAAC
JMSF045P12+ CAGAGATCTTTGGAGAAAATTCGGAACGACTGTCTTT
JMFN005A19+ CAGAGATCTTTGGAGAAAATTCGGAACGACTGTCTTTGACCAGTTTGCG
JMFF039B01+ CAGAGATCTTTGGAGAAAATTCGGAAC
JMFN037I17- CAGAGATCTTTGGAGAAAATTCGGAACGACTGTCTTTGACCAGTTTGCG
JMFN036H10+ CAGAGATCTTTGGAGAAAATTCGGAACGACTGTCTTTGACCAGTTTGCG
JMFN001D11+ CAGAGATCTTTGGAGAAAATTCGGAACGACTGTCTTTGACCAGTTTGCGATTGCGGCTAT
                      ____________________________________________________________
consensus CAGAGATCTTTGGAGAAAATTCGGAACGACTGTCTTTGACCAGTTTGCGATTGCGGCTAT