Previous Contig 002223:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051P10Sequence561002223 (3)457011124 (2)
JMFS023F05Sequence540002223 (3)gb:AY054177_15629996e-09Arabidopsis thaliana At1g29690/F15D2_24 mRNA, complete cds.
JMSF025F05Sequence658002223 (3)674011124 (2)pir|C86420|C864207e-70unknown protein, 124288-121737 [imported] - Arabidopsis thaliana>gb:AE005172_891

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025F05+ CNNGNGNCNNNNGGCNNCNNNNNNTCNCCNNNCNAGCAANGTCNNNNGNGNGNTNTTN
                      ____________________________________________________________
consensus CNNGNGNCNNNNGGCNNCNNNNNNTCNCCNNNCNAGCAANGTCNNNNGNGNGNTNTTN
 
. : . : . : . : . : . :
JMSF025F05+ NNNANTNTNNNCANNNNNNGNNCCAGNCNNTNCNNNNCAGTAAAGCAATNNNGTNTCNTA
                      ____________________________________________________________
consensus NNNANTNTNNNCANNNNNNGNNCCAGNCNNTNCNNNNCAGTAAAGCAATNNNGTNTCNTA
 
. : . : . : . : . : . :
JMFS023F05+ GGCAGTATGCAAAGCCGC
JMSF025F05+ ATTCNCATCAAAACCCNTTNNCAANGCNTGCNNNGCATNTANGGCAGTANGCAAAGCCGN
JMFF051P10+ GGCAGTATGCAAAGCCGC
                      ____________________________________________________________
consensus ATTCNCATCAAAACCCNTTNNCAANGCNTGCNNNGCATNTANGGCAGTATGCAAAGCCGC
 
. : . : . : . : . : . :
JMFS023F05+ TTCCTTTTCCTCCATATCATCACCTCCCCCACCCAGCCCCAAACCCCAGTGCCCAAAAAA
JMSF025F05+ TTCCTTTTCCTCCATATCATCACCTCCCCCACCCAGCCCCAAACCCCAGTGCCCAAAAAA
JMFF051P10+ TTCCTTTTCCTCCATATCATCACCTCCCCCACCCAGCCCCAAACCCCAGTGCCCAAAAAA
                      ____________________________________________________________
consensus TTCCTTTTCCTCCATATCATCACCTCCCCCACCCAGCCCCAAACCCCAGTGCCCAAAAAA
 
. : . : . : . : . : . :
JMFS023F05+ TTAAACAAAAATTCCTCCTTATTCTTTAATTACAAATGCCAAGCAGAAATCCAATTCCAA
JMSF025F05+ TTAAACAAAAATTCCTCCTTATTCTTTAATTACAAATGCCAAGCAGAAATCCAATTCCAA
JMFF051P10+ TTAAACAAAAATTCCTCCTTATTCTTTAATTACAAATGCCAAGCAGAAATCCAATTCCAA
                      ____________________________________________________________
consensus TTAAACAAAAATTCCTCCTTATTCTTTAATTACAAATGCCAAGCAGAAATCCAATTCCAA
 
. : . : . : . : . : . :
JMFS023F05+ GCAAAGAGCAATCACCACATAGCAAATATATTCAGATAAACTTAACCCAAATCAAACGCT
JMSF025F05+ GCAAAGAGCAATCACCACATAGCAAATATATTCAGATAAACTTAACCCAAATCAAACGCT
JMFF051P10+ GCAAAGAGCAATCACCACATAGCAAATATATTCAGATAAACTTAACCCAAATCAAACGCT
                      ____________________________________________________________
consensus GCAAAGAGCAATCACCACATAGCAAATATATTCAGATAAACTTAACCCAAATCAAACGCT
 
. : . : . : . : . : . :
JMFS023F05+ AACCCTATCTTGCTCTACCACAATACTTTTACCAAATCAAGAGTAAAGATTCAATCTTTT
JMSF025F05+ AACCCTATCTTGCTCTACCACAATACTTTTACCAAATCAAGAGTAAAGATTCAATCTTTT
JMFF051P10+ AACCCTATCTTGCTCTACCACAATACTTTTACCAAATCAAGAGTAAAGATTCAATCTTTT
                      ____________________________________________________________
consensus AACCCTATCTTGCTCTACCACAATACTTTTACCAAATCAAGAGTAAAGATTCAATCTTTT
 
. : . : . : . : . : . :
JMFS023F05+ TCAGATCAGATAACCCCCAAAGCTACAAATTCCATTACCCTAATCTCAAAACTCTCTAAA
JMSF025F05+ TCAGATCAGATAACCCCCAAAGCTACAAATTCCATTACCCTAATCTCAAAACTCTCTAAA
JMFF051P10+ TCAGATCAGATAACCCCCAAAGCTACAAATTCCATTACCCTAATCTCAAAACTCTCTAAA
                      ____________________________________________________________
consensus TCAGATCAGATAACCCCCAAAGCTACAAATTCCATTACCCTAATCTCAAAACTCTCTAAA
 
. : . : . : . : . : . :
JMFS023F05+ GGTTGACCATAAGAAATTACCCAG-AAGATTTGAACCGATACTTCAGCTAAGAACAGATC
JMSF025F05+ GGTTGACCATAAGAAATTACCCAGAAAGATTTGAACCGATACTTCAGCTAAGAACAGATC
JMFF051P10+ GGTTGACCATAAGAAATTACCCAGAAAGATTTGAACCGATACTTCAGCTAAGAA-AGATC
                      ____________________________________________________________
consensus GGTTGACCATAAGAAATTACCCAGAAAGATTTGAACCGATACTTCAGCTAAGAACAGATC
 
. : . : . : . : . : . :
JMFS023F05+ TTGAATCTTCCAACTCAGAACTTCAGATTTCCTA
JMSF025F05+ TTGAATCTTCCAACTCAGAACTTCAGATTTCCTATCTCCTTTCCCCCTCTCTCTCTATAT
JMFF051P10+ TTGAATCTTCCAACTCAGAACTTCAGATTTCCTATCTCCTTTCCCCCTCTCTCTCTATAT
                      ____________________________________________________________
consensus TTGAATCTTCCAACTCAGAACTTCAGATTTCCTATCTCCTTTCCCCCTCTCTCTCTATAT
 
. : . : . : . : . : . :
JMSF025F05+ ATATATCTATCTACAATCTATACATGTGTATATCTGATGCCTCTCCTCTCCCTCCCCCC
JMFF051P10+ ATATATCTATCTACAATCTATACATGTGTATATCTGATGCCTCTCCTCTCCCTCCCCCCC
                      ____________________________________________________________
consensus ATATATCTATCTACAATCTATACATGTGTATATCTGATGCCTCTCCTCTCCCTCCCCCCC