Previous Contig 002221:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051O19Sequence624002221 (2)pir|G84697|G846972e-64hypothetical protein At2g29560 [imported] - Arabidopsis thaliana>gb:AC004561_153
JMSF021I17Sequence688002221 (2)pir|G84697|G846972e-97hypothetical protein At2g29560 [imported] - Arabidopsis thaliana>gb:AC004561_153748013470 (5)pir|G84697|G846974e-76hypothetical protein At2g29560 [imported] - Arabidopsis thaliana>gb:AC004561_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021I17+ TGGGAGAATCATGATTTCCTGTACAGCCAAGTTGTTCCCAGCATGT
                      ____________________________________________________________
consensus TGGGAGAATCATGATTTCCTGTACAGCCAAGTTGTTCCCAGCATGT
 
. : . : . : . : . : . :
JMSF021I17+ TTTCCACCACTTATGAGAGTGAAGGCAGGAACAGGAAGAAGCAGATTGGTTTTTCCAGAA
                      ____________________________________________________________
consensus TTTCCACCACTTATGAGAGTGAAGGCAGGAACAGGAAGAAGCAGATTGGTTTTTCCAGAA
 
. : . : . : . : . : . :
JMSF021I17+ AGATCAGCAATGTGTTTATAAAGTGGAACCTCTTTTTCAGCAGCTCCGGCTTTACAAGCA
                      ____________________________________________________________
consensus AGATCAGCAATGTGTTTATAAAGTGGAACCTCTTTTTCAGCAGCTCCGGCTTTACAAGCA
 
. : . : . : . : . : . :
JMSF021I17+ GCCATGGATACAGCTAAAATGGCATTTGCTCCAAGTTCACCCTTCTTCTCTGTCTTGTCC
JMFF051O19+ TCACCCTTCTTCTCTGTCTTGTCC
                      ____________________________________________________________
consensus GCCATGGATACAGCTAAAATGGCATTTGCTCCAAGTTCACCCTTCTTCTCTGTCTTGTCC
 
. : . : . : . : . : . :
JMSF021I17+ AAATCTATCATGGCCTGATCGATTTGAGACTGAAGTGTTGGATCCATACCAATCAAAGCT
JMFF051O19+ AAATCTATCATGGCCTGATCGATTTGAGACTGAAGTGTTGGATCCATACCAATCAAAGCT
                      ____________________________________________________________
consensus AAATCTATCATGGCCTGATCGATTTGAGACTGAAGTGTTGGATCCATACCAATCAAAGCT
 
. : . : . : . : . : . :
JMSF021I17+ TCGGATATTTTTTCATTGATATTCTTCACAGCTCTGCTAACACCATTTCCAAGATACGTC
JMFF051O19+ TCGGATATTTTTTCATTGATATTCTTCACAGCTCTGCTAACACCATTTCCAAGATACGTC
                      ____________________________________________________________
consensus TCGGATATTTTTTCATTGATATTCTTCACAGCTCTGCTAACACCATTTCCAAGATACGTC
 
. : . : . : . : . : . :
JMSF021I17+ CCTTTGTCTGCATCACGTAACTCAATAGCCTCATACATTCCCAAGGAAGCACCGCTGGGG
JMFF051O19+ CCTTTGTCTGCATCACGTAACTCAATAGCCTCATACATTCCCAAGGAAGCACCGCTGGGG
                      ____________________________________________________________
consensus CCTTTGTCTGCATCACGTAACTCAATAGCCTCATACATTCCCAAGGAAGCACCGCTGGGG
 
. : . : . : . : . : . :
JMSF021I17+ GCAGAAGCTCGAAACATGCCTTTATTTGTGTACAAATCGACTTCGACTGTAGGAATGCCT
JMFF051O19+ GCAGAAGCTCGAAACATGCCTTTATTTGTGTACAAATCGACTTCGACTGTAGGAATGCCT
                      ____________________________________________________________
consensus GCAGAAGCTCGAAACATGCCTTTATTTGTGTACAAATCGACTTCGACTGTAGGAATGCCT
 
. : . : . : . : . : . :
JMSF021I17+ CTACTATCGAGAATTTGCCTCGCTTTCAGCTTCGTTATTACCGATGGCACGGATTTTCTC
JMFF051O19+ CTACTATCGAGAATTTGCCTCGCTTTCAGCTTCGTTATTACCGATGGCACGGATTTTCTC
                      ____________________________________________________________
consensus CTACTATCGAGAATTTGCCTCGCTTTCAGCTTCGTTATTACCGATGGCACGGATTTTCTC
 
. : . : . : . : . : . :
JMSF021I17+ ATATGATTAGAGATGAAGAGGACAGGATCGGAAGTCTTTGCCCGGACGGCGGCATTAACG
JMFF051O19+ ATATGATTAGAGATGAAGAGGACAGGATCGGAAGTCTTCGCCCGGACGGCGGCATTAACG
                      ____________________________________________________________
consensus ATATGATTAGAGATGAAGAGGACAGGATCGGAAGTCTTTGCCCGGACGGCGGCATTAACG
 
. : . : . : . : . : . :
JMSF021I17+ GCATCTTCGAGTTTCCGAGAAAGCATGTGCTTATCCAGATACTCTTGCACGGACATTTTC
JMFF051O19+ GCATCTTCGAGTTTCCGAGAAAGCATGTGCTTATCCAGATACTCTTGCACGGACATTTTC
                      ____________________________________________________________
consensus GCATCTTCGAGTTTCCGAGAAAGCATGTGCTTATCCAGATACTCTTGCACGGACATTTTC
 
. : . : . : . : . : . :
JMSF021I17+ TCGGAGGTGGGAAGATTTGCAGAAGTGGAAGAGCTGAAGGT
JMFF051O19+ TCGGAGGTGGGAAGATTTGCAGAAGTGGAAGAGCTGAAGGTGAAGTTAATGAGTTATAGA
                      ____________________________________________________________
consensus TCGGAGGTGGGAAGATTTGCAGAAGTGGAAGAGCTGAAGGTGAAGTTAATGAGTTATAGA
 
. : . : . : . : . : . :
JMFF051O19+ GATGAGACTTAATTTTTTTTTTTTCTTTTTCTGATTTTTTTTGAAATTGAATCCGGGGAC
                      ____________________________________________________________
consensus GATGAGACTTAATTTTTTTTTTTTCTTTTTCTGATTTTTTTTGAAATTGAATCCGGGGAC
 
. : . : . : . : . : . :
JMFF051O19+ GAAGGGGCTACGGCCTGCAGGGATTTGGTTCGAGATCTGCACCTGTGACGACAAAGCCAC
                      ____________________________________________________________
consensus GAAGGGGCTACGGCCTGCAGGGATTTGGTTCGAGATCTGCACCTGTGACGACAAAGCCAC