Previous Contig 002217:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002F03Sequence391002217 (13)gb:AY616436_16181522e-44Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.739008235 (16)gb:AB055507_1521485e-101Lithospermum erythrorhizon C4H-1 mRNA for cinnamic acid 4-hydroxylase, complete
JMFF002K06Sequence547002217 (13)gb:AY616436_16181521e-75Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.667008235 (16)gb:AF286648_17832083e-64Gossypium arboreum cinnamate-4-hydroxylase mRNA, complete cds.
JMFF002O20Sequence513002217 (13)gb:AY616436_16181523e-70Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.654008235 (16)gb:AF378333_17933647e-77Citrus x paradisi cinnamate 4-hydroxylase mRNA, complete cds.
JMFF005J19Sequence411002217 (13)gb:AY616436_16181528e-49Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.575008235 (16)gb:AF286648_17832081e-74Gossypium arboreum cinnamate-4-hydroxylase mRNA, complete cds.
JMFF011A11Sequence520002217 (13)gb:AY616436_16181522e-71Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.708008235 (16)gb:AB055507_15214854e-71Lithospermum erythrorhizon C4H-1 mRNA for cinnamic acid 4-hydroxylase, complete
JMFF021E04Sequence510002217 (13)gb:AY616436_16181522e-69Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.681008235 (16)gb:AB055507_1521485e-100Lithospermum erythrorhizon C4H-1 mRNA for cinnamic acid 4-hydroxylase, complete
JMFF028N14Sequence516002217 (13)gb:AY616436_16181528e-71Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.459008235 (16)gb:AF088847_17672679e-32Capsicum chinense cinnamic acid 4-hydroxylase (Ca4h) mRNA, partial cds.
JMFF029B13Sequence456002217 (13)gb:AY616436_16181525e-59Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.575008235 (16)sp|P37115|TCMO_PHAAU5e-60Trans-cinnamate 4-monooxygenase (EC 1.14.13.11) (Cinnamic acid 4- hydroxylase) (
JMFF029F21Sequence479002217 (13)gb:AY616436_16181526e-63Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.730008235 (16)gb:AB055507_1521485e-105Lithospermum erythrorhizon C4H-1 mRNA for cinnamic acid 4-hydroxylase, complete
JMFF031I23Sequence514002217 (13)gb:AY616436_16181528e-71Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.621008235 (16)sp|P37115|TCMO_PHAAU1e-60Trans-cinnamate 4-monooxygenase (EC 1.14.13.11) (Cinnamic acid 4- hydroxylase) (
JMFF042L02Sequence649002217 (13)gb:AY616436_16181522e-93Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.544008235 (16)sp|P37115|TCMO_PHAAU1e-50Trans-cinnamate 4-monooxygenase (EC 1.14.13.11) (Cinnamic acid 4- hydroxylase) (
JMFF051N17Sequence575002217 (13)gb:AY616436_16181522e-79Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.575008235 (16)gb:AF286648_17832081e-72Gossypium arboreum cinnamate-4-hydroxylase mRNA, complete cds.
JMFS091A08Sequence627002217 (13)gb:AY616436_16181522e-90Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042L02+ GTCGAACATAATCCGGTACATGTTATTGTACATCAAGAGCTGGAGCCGCCGCCGC
                      ____________________________________________________________
consensus GTCGAACATAATCCGGTACATGTTATTGTACATCAAGAGCTGGAGCCGCCGCCGC
 
. : . : . : . : . : . :
JMFS091A08+ CCGGTGGTGGCCGCCTCGGGGTTGTTCTTCACGTCCTCCACCACGCTCGCG
JMFF042L02+ AGCACGGTGCCGGTGGTGGCCGCCTCGGGGTTGTTCTTCACGTCCTCCACCACGCTCGCG
JMFF002K06+ CACCACGCTCGCG
JMFF051N17+ GGGTTGTTCTTCACGTCCTCCACCACGCTCGCG
                      ____________________________________________________________
consensus AGCACGGTGCCGGTGGTGGCCGCCTCGGGGTTGTTCTTCACGTCCTCCACCACGCTCGCG
 
. : . : . : . : . : . :
JMFS091A08+ ATCTCCTTCTCCCACCCCTCCCGGTACTGCTGCACCACCTTGTTGGTGAAGAACGGCACC
JMFF042L02+ ATCTCCTTCTCCCACCCCTCCCGGTACTGCTGCACCACCTTGTTGGTGAAGAACGGCACC
JMFF011A11+ CCCCTCCCGGTACTGCTGCACCACCTTGTTGGTGAAGAACGGCACC
JMFF002O20+ CGGTACTGCTGCACCACCTTGTTGGTGAAGAACGGCACC
JMFF028N14+ TCCCGGTACTGCTGCACCACCTTGTTGGTGAAGAACGGCACC
JMFF031I23+ CCGGTACTGCTGCACCACCTTGTTGGTGAAGAACGGCACC
JMFF021E04+ TACTGCTGCACCACCTTGTTGGTGAAGAACGGCACC
JMFF002K06+ ATCTCCTTCTCCCACCCCTCCCGGTACTGCTGCACCACCTTGTTGGTGAAGAACGGCACC
JMFF029F21+ ACC
JMFF051N17+ ATCTCCTTCTCCCACCCCTCCCGGTACTGCTGCACCACCTTGTTGGTGAAGAACGGCACC
                      ____________________________________________________________
consensus ATCTCCTTCTCCCACCCCTCCCGGTACTGCTGCACCACCTTGTTGGTGAAGAACGGCACC
 
. : . : . : . : . : . :
JMFS091A08+ GTCATGATCCGCCGCATCTTCCGCCAGTGCTCGCCGTAGACGGTGAACACCATGTCCTGT
JMFF042L02+ GTCATGATCCGCCGCATCTTCCGCCAGTGCTCGCCGTAGACGGTGAACACCATGTCCTGT
JMFF011A11+ GTCATGATCCGCCGCATCTTCCGCCAGTGCTCGCCGTAGACGGTGAACACCATGTCCTGT
JMFF002O20+ GTCATGATCCGCCGCATCTTCCGCCAGTGCTCGCCGTAGACGGTGAACACCATGTCCTGT
JMFF028N14+ GTCATGATCCGCCGCATCTTCCGCCAGTGCTCGCCGTAGACGGTGAACACCATGTCCTGT
JMFF031I23+ GTCATGATCCGCCGCATCTTCCGCCAGTGCTCGCCGTAGACGGTGAACACCATGTCCTGT
JMFF021E04+ GTCATGATCCGCCGCATCTTCCGCCAGTGCTCGCCGTAGACGGTGAACACCATGTCCTGT
JMFF029B13+ TTCCGCCAGTGCTCGCCGTAGACGGTGAACACCATGTCCTGT
JMFF002K06+ GTCATGATCCGCCGCATCTTCCGCCAGTGCTCGCCGTAGACGGTGAACACCATGTCCTGT
JMFF029F21+ GTCATGATCCGCCGCATCTTCCGCCAGTGCTCGCCGTAGACGGTGAACACCATGTCCTGT
JMFF051N17+ GTCATGATCCGCCGCATCTTCCGCCAGTGCTCGCCGTAGACGGTGAACACCATGTCCTGT
                      ____________________________________________________________
consensus GTCATGATCCGCCGCATCTTCCGCCAGTGCTCGCCGTAGACGGTGAACACCATGTCCTGT
 
. : . : . : . : . : . :
JMFS091A08+ CCCTTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
JMFF042L02+ CCCTTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
JMFF011A11+ CCCTTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
JMFF002O20+ CCCTTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
JMFF028N14+ CCCTTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
JMFF031I23+ CCCTTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
JMFF021E04+ CCCTTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
JMFF029B13+ CCCTTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
JMFF005J19+ TTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
JMFF002K06+ CCCTTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
JMFF029F21+ CCCTTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
JMFF002F03+ CACCNCGTTCCGAGTGCGGGACCCGAACTCCACCCCC
JMFF051N17+ CCCTTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
                      ____________________________________________________________
consensus CCCTTCCCGGTGAAGATGTCGAACACCACGTTCCGAGTGCGGGACCCGAACTCCACCCCC
 
. : . : . : . : . : . :
JMFS091A08+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
JMFF042L02+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
JMFF011A11+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
JMFF002O20+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
JMFF028N14+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
JMFF031I23+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
JMFF021E04+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
JMFF029B13+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
JMFF005J19+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
JMFF002K06+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
JMFF029F21+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
JMFF002F03+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
JMFF051N17+ TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
                      ____________________________________________________________
consensus TGCGTGTGGAGCACCTCCTTGGCCAGCTCCGGCGAGGAGACGACCACTAAATTCCTCTGC
 
. : . : . : . : . : . :
JMFS091A08+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
JMFF042L02+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
JMFF011A11+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
JMFF002O20+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
JMFF028N14+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
JMFF031I23+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
JMFF021E04+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
JMFF029B13+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
JMFF005J19+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
JMFF002K06+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
JMFF029F21+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
JMFF002F03+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
JMFF051N17+ CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
                      ____________________________________________________________
consensus CCCATCCTCAGCATGAAAATGTCGCCGAATTTCTTCGCGTAGTCGGTGAGATTGCGGTGG
 
. : . : . : . : . : . :
JMFS091A08+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
JMFF042L02+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
JMFF011A11+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
JMFF002O20+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
JMFF028N14+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
JMFF031I23+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
JMFF021E04+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
JMFF029B13+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
JMFF005J19+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
JMFF002K06+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
JMFF029F21+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
JMFF002F03+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
JMFF051N17+ TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
                      ____________________________________________________________
consensus TTCAAATCATCCCCGACCTGAAGCCAGTTCCCGAACACCGGCACCGGAATCGGCCCCGGC
 
. : . : . : . : . : . :
JMFS091A08+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
JMFF042L02+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
JMFF011A11+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
JMFF002O20+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
JMFF028N14+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
JMFF031I23+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
JMFF021E04+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
JMFF029B13+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
JMFF005J19+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
JMFF002K06+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
JMFF029F21+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
JMFF002F03+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
JMFF051N17+ GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
                      ____________________________________________________________
consensus GGGAGCTTGTACTTCTTCCCGCGAAGCTTAGAGACAACAATGGCGACTATTATGGCTACG
 
. : . : . : . : . : . :
JMFS091A08+ AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
JMFF042L02+ AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
JMFF011A11+ AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
JMFF002O20+ AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
JMFF028N14+ AAGAGCCCTAAAAGGGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
JMFF031I23+ AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
JMFF021E04+ AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
JMFF029B13+ AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
JMFF005J19+ AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
JMFF002K06+ AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
JMFF029F21+ AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
JMFF002F03+ AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
JMFF051N17+ AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
                      ____________________________________________________________
consensus AAGAGCCCTAAAAGAGTCTTCTCTAGAAGGAGAAGATCCATCTTCAAGGGCAAAATTGGA
 
. : . : . : . : . : . :
JMFS091A08+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGT
JMFF042L02+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGCTTCCT
JMFF011A11+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGCTTCCT
JMFF002O20+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGCTTCCT
JMFF028N14+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGCTTCC
JMFF031I23+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGCCTCCT
JMFF021E04+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGCTT
JMFF029B13+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGTTTCCT
JMFF005J19+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGCTT
JMFF002K06+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGCTTCCT
JMFF029F21+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGCTTCCT
JMFF002F03+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGCTTCCT
JMFF051N17+ AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGCTTCCTCGGTTC
                      ____________________________________________________________
consensus AAGAAATCTGCAAAATATATTATCAGAAAGGCAGGCGGGTATGCGTGGCTTCCTCGGTTC