Previous Contig 002206:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006J18Sequence490002206 (5)gb:CAR489614_16453493e-46Cicer arietinum mRNA for microtubule associated protein (map gene).733002206 (5)gb:CAR489614_16453493e-55Cicer arietinum mRNA for microtubule associated protein (map gene).
JMFF051I06Sequence561002206 (5)gb:CAR489614_16453491e-55Cicer arietinum mRNA for microtubule associated protein (map gene).
JMFN016E22Sequence609002206 (5)gb:CAR489614_16453492e-55Cicer arietinum mRNA for microtubule associated protein (map gene).
JMFN038A23Sequence625002206 (5)gb:CAR489614_16453492e-55Cicer arietinum mRNA for microtubule associated protein (map gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006J18- TTATATTAAAAGAAACAAGGAGAAATA
                      ____________________________________________________________
consensus TTATATTAAAAGAAACAAGGAGAAATA
 
. : . : . : . : . : . :
rJMFF006J18- AACAAAGGTGAATCCAAATAATTATTAAGATAATCTGCCACATTCTGGGAATATAGTCAA
                      ____________________________________________________________
consensus AACAAAGGTGAATCCAAATAATTATTAAGATAATCTGCCACATTCTGGGAATATAGTCAA
 
. : . : . : . : . : . :
rJMFF006J18- CTTGTCTGCAACTATACACAGTTAAATGCTATACATAGTGAAGCTAAAACTATTATCTGT
                      ____________________________________________________________
consensus CTTGTCTGCAACTATACACAGTTAAATGCTATACATAGTGAAGCTAAAACTATTATCTGT
 
. : . : . : . : . : . :
rJMFF006J18- AAAGCAAACAATAAAAGTGAACTTGGTTTTGATGAGTAATGGCAAAGCTGCAAAGAAAGT
JMFF051I06+ TGGCAAAGCTGCAAAGAAAGT
                      ____________________________________________________________
consensus AAAGCAAACAATAAAAGTGAACTTGGTTTTGATGAGTAATGGCAAAGCTGCAAAGAAAGT
 
. : . : . : . : . : . :
rJMFF006J18- TTTCCCGTGGCAGTATTGGAGGTCTAAAGCATGGTGTTGTCACCGAATGTGTTCTCCCCG
JMFN016E22+ CCGAATGTGTTCTCCCCG
JMFF006J18+ TGTTCTCCCCG
JMFN038A23+ CCGAATGTGTTCTCCCCG
JMFF051I06+ TTTCCCGTGGCAGTATTGGAGGTCTAAAGCATGGTGTTGTCACCGAATGTGTTCTCCCCG
                      ____________________________________________________________
consensus TTTCCCGTGGCAGTATTGGAGGTCTAAAGCATGGTGTTGTCACCGAATGTGTTCTCCCCG
 
. : . : . : . : . : . :
rJMFF006J18- CTGTAGGTGACATAGAGGAAACCATCTTCGTCCTTCTTCTCGTCATATACAGCAGACATG
JMFN016E22+ CTGTAGGTGACATAGAGGAAACCATCTTCGTCCTTCTTCTCGTCATATACAGCAGACATG
JMFF006J18+ CTGTAGGTGACATAGAGGAAACCATNTTCGTCCTTCTTCTCGTCATATACAGCAGACATG
JMFN038A23+ CTGTAGGTGACATAGAGGAAACCATCTTCGTCCTTCTTCTCGTCATATACAGCAGACATG
JMFF051I06+ CTGTAGGTGACATAGAGGAAACCATCTTCGTCCTTCTTCTCGTCATATACAGCAGACATG
                      ____________________________________________________________
consensus CTGTAGGTGACATAGAGGAAACCATCTTCGTCCTTCTTCTCGTCATATACAGCAGACATG
 
. : . : . : . : . : . :
rJMFF006J18- AGTGCTCCTGTTGGTGGGAGGACATTATCAACAAATATGAAAATTGCTTTCTCCGGGCTC
JMFN016E22+ AGTGCTCCTGTTGGTGGGAGGACATTATCAACAAATATGAAAATTGCTTTCTCCGGGCTC
JMFF006J18+ AGTGCTCCTGTTGGTGGGAGGACATTATCAACAAATATGAAAATTGCTTTNTCCGGGCTC
JMFN038A23+ AGTGCTCCTGTTGGTGGGAGGACATTATCAACAAATATGAAAATTGCTTTCTCCGGGCTC
JMFF051I06+ AGTGCTCCTGTTGGTGGGAGGACATTATCAACAAATATGAAAATTGCTTTCTCCGGGCTC
                      ____________________________________________________________
consensus AGTGCTCCTGTTGGTGGGAGGACATTATCAACAAATATGAAAATTGCTTTCTCCGGGCTC
 
. : . : . : . : . : . :
rJMFF006J18- AACTCAATCCTTTTGCGAATCACATACACGAATTGCCCTACCGTGAGGTCAGAAGGGACG
JMFN016E22+ AACTCAATCCTTTTGCGAATCACATACACGAATTGCCCTACCGTGAGGTCAGAAGGGACG
JMFF006J18+ AACTCAATCCTTTTGCGAATCACATACNCGAATTGCCCTACCGTGAGGTCAGAAGGGACG
JMFN038A23+ AACTCAATCCTTTTGCGAATCACATACACGAATTGCCCTACCGTGAGGTCAGAAGGGACG
JMFF051I06+ AACTCAATCCTTTTGCGAATCACATACACGAATTGCCCTACCGTGAGGTCAGAAGGGACG
                      ____________________________________________________________
consensus AACTCAATCCTTTTGCGAATCACATACACGAATTGCCCTACCGTGAGGTCAGAAGGGACG
 
. : . : . : . : . : . :
rJMFF006J18- AGATACTTTTTCTTGTCAATGTTCGGAATGTCGCTTCTCTCTGCCTTCTCAACAATCACC
JMFN016E22+ AGATACTTTTTCTTGTCAATGTTCGGAATGTCGCTTCTCTCTGCCTTCTCAACAATCACC
JMFF006J18+ AGATACTTTTTNTTGTCAATGTTCGGAANGTCGCTTCTCTNTGCCTTNTCAACAATCACC
JMFN038A23+ AGATACTTTTTCTTGTCAATGTTCGGAATGTCGCTTCTCTCTGCCTTCTCAACAATCACC
JMFF051I06+ AGATACTTTTTCTTGTCAATGTTCGGAATGTCGCTTCTCTCTGCCTTCTCAACAATCACC
                      ____________________________________________________________
consensus AGATACTTTTTCTTGTCAATGTTCGGAATGTCGCTTCTCTCTGCCTTCTCAACAATCACC
 
. : . : . : . : . : . :
rJMFF006J18- GGAATTCTCTCCGAATATTTTTCCCTAATCCGGCTAGCCTCAACCCGCCTCTTCTCAAGA
JMFN016E22+ GGAATTCTCTCCGAATATTTTTCCCTAATCCGGCTAGCCTCAACCCGCCTCTTCTCAAGA
JMFF006J18+ GGAATTCTCTCCGAATATTTTTCCCTAATCCGGCTAGCCTCAACCCGCCTNTTNTCAAGA
JMFN038A23+ GGAATTCTCTCCGAATATTTTTCCCTAATCCGGCTAGCCTCAACCCGCCTCTTCTCAAGA
JMFF051I06+ GGAATTCTCTCCGAATATTTTTCCCTAATCCGGCTAGCCTCAACCCGCCTCTTCTCAAGA
                      ____________________________________________________________
consensus GGAATTCTCTCCGAATATTTTTCCCTAATCCGGCTAGCCTCAACCCGCCTCTTCTCAAGA
 
. : . : . : . : . : . :
rJMFF006J18- TCATGCTGTTGCTTGAATGAACTCTTCGCCATCCCGTCCGATTACAGCAACCTAGAATGA
JMFN016E22+ TCATGCTGTTGCTTGAATGAACTCTTCGCCATCCCGTCCGATTACAGCAACCTAGAATGA
JMFF006J18+ TCATGCTGTTGCTTGAATGAACTNTTCGCCATCCCGTCCGATTACAGCAACCTAGAATGA
JMFN038A23+ TCATGCTGTTGCTTGAATGAACTCTTCGCCATCCCGTCCGATTACAGCAACCTAGAATGA
JMFF051I06+ TCATGCTGTTGCTTGAATGAACTCTTCGCCATCCCGTCCGATTACAGCAACCTAGAATGA
                      ____________________________________________________________
consensus TCATGCTGTTGCTTGAATGAACTCTTCGCCATCCCGTCCGATTACAGCAACCTAGAATGA
 
. : . : . : . : . : . :
rJMFF006J18- TAAAGTTGGAAGAAAGCAGATTCTTTGTAGAGTCGAGTGAATTCTTGTACTCTCTGCTTC
JMFN016E22+ TAAAGTTGGAAGAAAGCAGATTCTTTGTAGAGTCGAGTGAATTCTTGTACTCTCTGCTTC
JMFF006J18+ TAAAGTTGGAAGAAAGCAGATTCTTTGTAGAGTCGAGTGAATTCTTGTACTCTCTGCTTC
JMFN038A23+ TAAAGTTGGAAGAAAGCAGATTCTTTGTAGAGTCGAG
JMFF051I06+ TAAAGTTGGAAGAAAGCAGATTCTTTGTAGAGTCGAGTGAATTCTTGTACTCTCTGCTTC
                      ____________________________________________________________
consensus TAAAGTTGGAAGAAAGCAGATTCTTTGTAGAGTCGAGTGAATTCTTGTACTCTCTGCTTC
 
. : . : . : . : . : . :
rJMFF006J18- TATCTAGTCTAGTGTATATATATAGGGAATAGTAGTGAATGAAGTA
JMFN016E22+ TATCTAGTCTAGTGTATATATATAGGGAA
JMFF006J18+ TATCTAGTCTAGTGTATATATATAGGGAATAGTAGTGAATGAAGTAGAATTTCAAAAGT
JMFF051I06+ TATCTAGTCTAGTGTATATATATAGGGAATAGTAGTGAATGAAGTAGAATTTCAAAAGTC
                      ____________________________________________________________
consensus TATCTAGTCTAGTGTATATATATAGGGAATAGTAGTGAATGAAGTAGAATTTCAAAAGTC