Previous Contig 002196:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013A10Sequence471002196 (4)gb:AY050426_15622038e-44Arabidopsis thaliana AT5g19180/T24G5_80 mRNA, complete cds.>gb:AY120692_1579574
JMFF026P16Sequence527002196 (4)gb:AY050426_15622032e-52Arabidopsis thaliana AT5g19180/T24G5_80 mRNA, complete cds.>gb:AY120692_1579574 711011075 (3)gb:AY050426_15622035e-26Arabidopsis thaliana AT5g19180/T24G5_80 mRNA, complete cds.>gb:AY120692_1579574
JMFF051F12Sequence557002196 (4)gb:AY050426_15622032e-50Arabidopsis thaliana AT5g19180/T24G5_80 mRNA, complete cds.>gb:AY120692_1579574 600011075 (3)gb:AY050426_15622035e-09Arabidopsis thaliana AT5g19180/T24G5_80 mRNA, complete cds.>gb:AY120692_1579574
JMSF001J07Sequence266002196 (4)gb:AY050426_15622031e-09Arabidopsis thaliana AT5g19180/T24G5_80 mRNA, complete cds.>gb:AY120692_1579574 727011075 (3)gb:AY050426_15622031e-37Arabidopsis thaliana AT5g19180/T24G5_80 mRNA, complete cds.>gb:AY120692_1579574

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF026P16+ TAATTGTTTCTTCTATTGGGTTGTCATCAGAGTCGTACT
JMFF051F12+ GTCATCAGAGTCGTACT
                      ____________________________________________________________
consensus TAATTGTTTCTTCTATTGGGTTGTCATCAGAGTCGTACT
 
. : . : . : . : . : . :
JMFF026P16+ CTAGGAATCCGCAGGCCACAGCATTTATGTAGCTCCGAGCCTCCACAGAATCAAGGCCAA
JMFF013A10+ ACAGCATTTATGTAGCTNCGAGCCTCCACAGAATCAAGGCCAA
JMFF051F12+ CTAGGAATCCGCAGGCCACAGCATTTATGTAGCTCCGAGCCTCCACAGAATCAAGGCCAA
                      ____________________________________________________________
consensus CTAGGAATCCGCAGGCCACAGCATTTATGTAGCTCCGAGCCTCCACAGAATCAAGGCCAA
 
. : . : . : . : . : . :
JMFF026P16+ GAACAATAATGTGGAAATCACTATAGAAGCTTAATGGTTTATCCTCAATTCGGCAGAAAT
JMFF013A10+ GAACAATAATGTGGAAATCACTATAGAAGCTTAATGGTTTATCCTCAATTCGGCAGAAAT
JMFF051F12+ GAACAATAATGTGGAAATCACTATAGAAGCTTAATGGTTTATCCTCAATTCGGCAGAAAT
                      ____________________________________________________________
consensus GAACAATAATGTGGAAATCACTATAGAAGCTTAATGGTTTATCCTCAATTCGGCAGAAAT
 
. : . : . : . : . : . :
JMFF026P16+ GTGGTATGATATTCACACCACTAACTCTTTCCATCACTCGCTTTGCAGCAACTTCAGCCT
JMFF013A10+ GTGGTATGATATTCACACCACTAACTCTTTCCATCACTCGCTTTGCAGCAACTTCAGCCT
JMFF051F12+ GTGGTATGATATTCACACCACTAACTCTTTCCATCACTCGCTTTGCAGCAACTTCAGCCT
                      ____________________________________________________________
consensus GTGGTATGATATTCACACCACTAACTCTTTCCATCACTCGCTTTGCAGCAACTTCAGCCT
 
. : . : . : . : . : . :
JMFF026P16+ TTGGCTTCCCCACATCTTCAAGTCTGAAGAGAAATTGGCGATTGAGATTGGTGACTTCGA
JMFF013A10+ TTGGCTTCCCCACATCTTCAAGTCTGAAGAGAAATTGGCGATTGAGATTGGTGACTTCGA
JMSF001J07+ AGATTGGTGACTTCGA
JMFF051F12+ TTGGCTTCCCCACATCTTCAAGTCTGAAGAGAAATTGGCGATTGAGATTGGTGACTTCGA
                      ____________________________________________________________
consensus TTGGCTTCCCCACATCTTCAAGTCTGAAGAGAAATTGGCGATTGAGATTGGTGACTTCGA
 
. : . : . : . : . : . :
JMFF026P16+ TTCTGTCCATATCAATCACCTCAAGGTTTTGAAAACCCGATAGAGCCAAGTCCTTGAGCA
JMFF013A10+ TTCTGTCCATATCAATCACCTCAAGGTTTTGAAAACCCGATAGAGCCAAGTCCTTGAGCA
JMSF001J07+ TTCTGTCCATATCAATCACCTCAAGGTTTTGAAAACCCGATAGAGCCAAGTCCTTGAGCA
JMFF051F12+ TTCTGTCCATATCAATCACCTCAAGGTTTTGAAAACCCGATAGAGCCAAGTCCTTGAGCA
                      ____________________________________________________________
consensus TTCTGTCCATATCAATCACCTCAAGGTTTTGAAAACCCGATAGAGCCAAGTCCTTGAGCA
 
. : . : . : . : . : . :
JMFF026P16+ ATTCACAACCCAATCCACCCGCCCCAACCACCAACAGCCTAGCAACCTCCTTGATGTCAT
JMFF013A10+ ATTCACAACCCAATCCACCCGCCCCAACCACCAACAGCCTAGCAACCTCCTTGATGTCAT
JMSF001J07+ ATTCACAACCCAATCCACCCGCCCCAACCACCAACAGCCTAGCAACCTCCTTGATGTCAT
JMFF051F12+ ATTCACAACCCAATCCACCCGCCCCAACCACCAACAGCCTAGCAACCTCCTTGATGTCAT
                      ____________________________________________________________
consensus ATTCACAACCCAATCCACCCGCCCCAACCACCAACAGCCTAGCAACCTCCTTGATGTCAT
 
. : . : . : . : . : . :
JMFF026P16+ CTCTCAGCTCTTCCCCGGGCTCGAAAGCTGGCCCGACGAGGTGGCCGGGTCGGAGAAGGA
JMFF013A10+ CTCTCAGCTCTTCCCCGGGCTCGAAAGCTGGCCCGACGAGGTGGCCGGGTCGGAGAAGGA
JMSF001J07+ CTCTCAGCTCTTCCCCGGGCTCGAAAGCTGGCCCGACGAGGTGGCCGGGTCGGAGAAGGA
JMFF051F12+ CTCTCAGCTCTTCCCCGGGCTCGAAAGCTGGCCCGACGAGGTGGCCGGGTCGGAGAAGGA
                      ____________________________________________________________
consensus CTCTCAGCTCTTCCCCGGGCTCGAAAGCTGGCCCGACGAGGTGGCCGGGTCGGAGAAGGA
 
. : . : . : . : . : . :
JMFF026P16+ GCTTGTCGAGGTCGCGCGATCGGCTTTGGACGGCGGAATCCGCCATTGATGGAGTACAGA
JMFF013A10+ GCTTGTCGAGGTCGCGCGATCGGCTTTGGACGGCGGAATCCGCCATTGATGGAGTACAGA
JMSF001J07+ GCTTGTCGAGGTCGCGCGATCGGCTTTGGACGGCGGAATCCGCCATTGATGGAGTACAGA
JMFF051F12+ GCTTGTCGAGGTCGCGCGATCGGCTTTGGACGGCGGAATCCGCCATTGATGGAGTACAGA
                      ____________________________________________________________
consensus GCTTGTCGAGGTCGCGCGATCGGCTTTGGACGGCGGAATCCGCCATTGATGGAGTACAGA
 
. : . : . : . : . : . :
JMFF026P16+ ATTAGTAT
JMFF013A10+ ATTAGTAT
JMSF001J07+ ATTAGTAT
JMFF051F12+ ATTAGTATCGAAGTAGCAGAAGGATGTATGGTTTCGCGTTTATTGGGTATGGTGGCTTGT
                      ____________________________________________________________
consensus ATTAGTATCGAAGTAGCAGAAGGATGTATGGTTTCGCGTTTATTGGGTATGGTGGCTTGT