Previous Contig 002195:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019H22Sequence576002195 (12)pir|S31196|S311965e-46hypothetical protein - potato718011073 (10)pir|S31196|S311966e-59hypothetical protein - potato
JMFF025G07Sequence487002195 (12)pir|S31196|S311962e-37hypothetical protein - potato
JMFF029E11Sequence498002195 (12)pir|S31196|S311965e-38hypothetical protein - potato685011073 (10)pir|S31196|S311962e-36hypothetical protein - potato
JMFF035K09Sequence485002195 (12)pir|S31196|S311961e-35hypothetical protein - potato665011073 (10)pir|S31196|S311965e-51hypothetical protein - potato
JMFF036P21Sequence431002195 (12)pir|S31196|S311963e-33hypothetical protein - potato663011073 (10)pir|S31196|S311961e-52hypothetical protein - potato
JMFF037I23Sequence366002195 (12)pir|S31196|S311961e-22hypothetical protein - potato
JMFF037J11Sequence367002195 (12)pir|S31196|S311962e-22hypothetical protein - potato
JMFF051F06Sequence495002195 (12)pir|S31196|S311961e-36hypothetical protein - potato462011073 (10)
JMFS158B03Sequence376002195 (12)pir|S31196|S311962e-39hypothetical protein - potato
JMSF003G07Sequence381002195 (12)pir|S31196|S311962e-21hypothetical protein - potato742011073 (10)pir|S31196|S311969e-51hypothetical protein - potato
JMSF017E23Sequence447002195 (12)pir|S31196|S311969e-37hypothetical protein - potato745011073 (10)pir|S31196|S311961e-51hypothetical protein - potato
JMSF046L04Sequence752002195 (12)pir|S31196|S311961e-76hypothetical protein - potato719011073 (10)pir|S31196|S311963e-57hypothetical protein - potato

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046L04+ GGAACAGCACGAAATCCAGCTTCCACAT
                      ____________________________________________________________
consensus GGAACAGCACGAAATCCAGCTTCCACAT
 
. : . : . : . : . : . :
JMSF046L04+ GGTTGGGATGCGCCTTGTAGGCGAAATACGGATACGCATTGATGAGAAAAGGGGATCCGG
                      ____________________________________________________________
consensus GGTTGGGATGCGCCTTGTAGGCGAAATACGGATACGCATTGATGAGAAAAGGGGATCCGG
 
. : . : . : . : . : . :
JMSF046L04+ TTTTGACATGGAACTTGAGGATCTCGCAAACGCAGGCCACCAGATCTCGCTTGAAAGCCC
                      ____________________________________________________________
consensus TTTTGACATGGAACTTGAGGATCTCGCAAACGCAGGCCACCAGATCTCGCTTGAAAGCCC
 
. : . : . : . : . : . :
JMSF046L04+ CGGAGGACGGCGGATACGACGACTCCAGCACCGCCAGGGAGTGCGCCGTCGTCACGTCGA
                      ____________________________________________________________
consensus CGGAGGACGGCGGATACGACGACTCCAGCACCGCCAGGGAGTGCGCCGTCGTCACGTCGA
 
. : . : . : . : . : . :
JMFS158B03+ CACCAGAGCGGCGTGAACGCTGTACATAGCCGGGAGGA
JMSF046L04+ TCTCCCCCTCCAGGTTTAGCTTCACCAGAGCGGCGTGAACGCTGTACATAGCCGGGAGGA
JMFF019H22+ CACCAGAGCGGCGTGAACGCTGTACATAGCCGGGAGGA
                      ____________________________________________________________
consensus TCTCCCCCTCCAGGTTTAGCTTCACCAGAGCGGCGTGAACGCTGTACATAGCCGGGAGGA
 
. : . : . : . : . : . :
JMFS158B03+ GGTAGTTGGCGAGAGAGGCGTCCTTGGAGCTCAGGACCTCGTTCCCGACGGCGATGCAGG
JMSF046L04+ GGTAGTTGGCGAGAGATGCGTCCTTGGAGCTCAGGACCTCGTTCCCGACGGCGATGCAGG
JMFF029E11+ GTTCCCGACGGCGATGCAGG
JMFF025G07+ CCCGACGGCGATGCAGG
JMFF035K09+ ACGGCGATGCAGG
JMSF017E23+ GACGGCGATGCAGG
JMFF019H22+ GGTAGTTGGCGAGAGAGGCGTCCTTGGAGCTCAGGACCTCGTTCCCGACGGCGATGCAGG
JMFF051F06+ CCGACGGCGATGCAGG
                      ____________________________________________________________
consensus GGTAGTTGGCGAGAGAGGCGTCCTTGGAGCTCAGGACCTCGTTCCCGACGGCGATGCAGG
 
. : . : . : . : . : . :
JMFS158B03+ TGATTTTGGTCGCCGGTAAATACGCCGCCACGTTNTGCCTCACCCACGCCTCCGCTTTCT
JMSF046L04+ TGATTTTGGTCGCCGGTAAATACGCCGCCACGTTCTGCCTCACCCACGCCTCCGCTTTCT
JMFF029E11+ TGATTTTGGTCGCCGGTAAATACGCCGCCACGTTCTGCCTCACCCACGCCTCCGCTTTCT
JMFF025G07+ TGATTTTGGTCGCCGGTAAATACGCCGCCACGTTCTGCCTCACCCACGCCTCCGCTTTCT
JMFF035K09+ TGATTTTGGTCGCCGGTAAATACGCCGCCACGTTCTGCCTCACCCACGCCTCCGCTTTCT
JMSF017E23+ TGATTTTGGTCGCCGGTAAATACGCCGCCACGTTCTGCCTCACCCACGCCTCCGCTTTCT
JMFF036P21+ TTTGGTCGCCGGTAAATACGCCGCCACGTTCTGCCTCACCCACGCCTCCGCTTTCT
JMFF019H22+ TGATTTTGGTCGCCGGTAAATACGCCGCCACGTTCTGCCTCACCCACGCCTCCGCTTTCT
JMFF051F06+ TGATTTTGGTCGCCGGTAAATACGCCGCCACGTTTTGCCTCACCCACGCCTCCGCTTTNT
                      ____________________________________________________________
consensus TGATTTTGGTCGCCGGTAAATACGCCGCCACGTTCTGCCTCACCCACGCCTCCGCTTTCT
 
. : . : . : . : . : . :
JMFS158B03+ CAGGATCCTTCACTTTACACAGCTCGCCTGTTGGTAACACTCACAATGAACTCCACGTTC
JMSF046L04+ CAGGATCCTTCACTTTACACAGCTCG-TTGTTGGTAACACTCACAATGAACTCCACGTTC
JMFF029E11+ CAGGATCCTTCACTTTACACAGCTCG-TTGTTGGTAACACTCACAATGAACTCCACGTTC
JMFF025G07+ CAGGATCCTTCACTTTACACAGCTCG-TTGTTGGTAACACTCACAATGAACTCCACGTTC
JMFF035K09+ CAGGATCGTTCACTTTACACAGCTCG-TTGTTGGTAACACTCACAATGAACTCCACGTTC
JMSF017E23+ CAGGATCCTTCACTTTACACAGCTCG-TTGTTGGTAACACTCACAATGAACTCCACGTTC
JMFF036P21+ CAGGATCCTTCACTTTACACAGCTCG-TTGTTGGTAACACTCACAATGAACTCCACGTTC
JMSF003G07+ GTAACACTCACAATGAACTCCACGTTC
JMFF037I23+ TTCACTTTACACAGCTCG-TTGTTGGTAACACTCACAATGAACTCCACGTTC
JMFF037J11+ CAGCTCG-TTGTTGGTAACACTCACAATGAACTCCACGTTC
JMFF019H22+ CAGGATCCTTCACTTTACACAGCTCG-TTGTTGGTAACACTCACAATGAACTCCACGTTC
JMFF051F06+ CAGGATCCTTCACTTTACACAGCTCG-TTGTTGGTAACACTCACAATGAACTCCACGTTC
                      ____________________________________________________________
consensus CAGGATCCTTCACTTTACACAGCTCG-TTGTTGGTAACACTCACAATGAACTCCACGTTC
 
. : . : . : . : . : . :
JMFS158B03+ GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
JMSF046L04+ GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
JMFF029E11+ GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
JMFF025G07+ GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
JMFF035K09+ GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
JMSF017E23+ GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
JMFF036P21+ GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
JMSF003G07+ GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
JMFF037I23+ GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
JMFF037J11+ GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
JMFF019H22+ GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
JMFF051F06+ GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
                      ____________________________________________________________
consensus GTGTTGGCGAAGGCTTTCAGCACCTTTGAATCCGCGTCGTAAAGCTTCAGCCTCGTTACG
 
. : . : . : . : . : . :
JMFS158B03+ CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
JMSF046L04+ CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
JMFF029E11+ CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
JMFF025G07+ CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
JMFF035K09+ CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
JMSF017E23+ CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
JMFF036P21+ CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
JMSF003G07+ CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
JMFF037I23+ CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
JMFF037J11+ CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
JMFF019H22+ CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
JMFF051F06+ CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
                      ____________________________________________________________
consensus CCCATGGACTTCACCAGCGGAACCACATTTTCCGGCGACGGCAGGTTGTTCGCAATCTGC
 
. : . : . : . : . : . :
JMFS158B03+ CCGTAATTGATGCCAATGCTAGTCACCACCA
JMSF046L04+ CCGTAATTGATGCCAATGCTAGTCACCACCACCGGCCAAAACATCACTGAGAAAAACAGT
JMFF029E11+ CCGTAATTGATGCCAATGCTAGTCACCACCACCGGCCAAAACATCACTGAGAAAAACAGT
JMFF025G07+ CCGTAATTGATGCCAATGCTAGTCACCACCACCGGCCAAAACATCACTGAGAAAAACAGT
JMFF035K09+ CCGTAATTGATGCCAATGCTAGTCACCACCACCGGCCAAAACATCACTGAGAAAAACAGT
JMSF017E23+ CCGTAATTGATGCCAATGCTAGTCACCACCACCGGCCAAAACATCACTGAGAAAAACAGT
JMFF036P21+ CCGTAATTGATGCCAATGCTAGTCACCACCACCGGCCAAAACATCACTGAGAAAAACAGT
JMSF003G07+ CCGTAATTGATGCCAATGCTAGTCACCACCACCGGCCAAAACATCACTGAGAAAAACAGT
JMFF037I23+ CCGTAATTGATGCCAATGCTAGTCACCACCACCGGCCAAAACATCACTGAGAAAAACAGT
JMFF037J11+ CCGTAATTGATGCCAATGCTAGTCACCACCACCGGCCAAAACATCACTGAGAAAAACAGT
JMFF019H22+ CCGTAATTGATGCCAATGCTAGTCACCACCACCGGCCAAAACATCACTGAGAAAAACAGT
JMFF051F06+ CCGTAATTGATGCCAATGCTAGTCACCACCACCGGCCAAAACATCACTGAGAAAAACAGT
                      ____________________________________________________________
consensus CCGTAATTGATGCCAATGCTAGTCACCACCACCGGCCAAAACATCACTGAGAAAAACAGT
 
. : . : . : . : . : . :
JMSF046L04+ GGAACTGAAAAACGGAGTTGAGAATTGAAGAAGAAAGCTTGCGGTTCCATCTAATTTAGT
JMFF029E11+ GGAACTGAAAAACGGAGTTGAGAATTGAAGAAGAAAGCTTGCGGTTCCATCTAATTTAGT
JMFF025G07+ GGAACTGAAAAACGGAGTTGAGAATTGAAGAAGAAAGCTTGCGGTTCCATCTAATTTAGT
JMFF035K09+ GGAACTGAAAAACGGAGTTGAGAATTGAAGAAGAAAGCTTGCGGTTCCATCTAATTTAGT
JMSF017E23+ GGAACTGAAAAACGGAGTTGAGAATTGAAGAAGAAAGCTTGCGGTTCCATCTAATTTAGT
JMFF036P21+ GGAACTGAAAAACGGAGTTGAGAATTGAAGAAGAAAGCTTGCGGTTCCATCTAATTTAGT
JMSF003G07+ GGAACTGAAAAACGGAGTTGAGAATTGAAGAAGAAAGCTTGCGGTTCCATCTAATTTAGT
JMFF037I23+ GGAACTGAAAAACGGAGTTGAGAATTGAAGAAGAAAGCTTGCGGTTCCATCTAATTTAGT
JMFF037J11+ GGAACTGAAAAACGGAGTTGAGAATTGAAGAAGAAAGCTTGCGGTTCCATCTAATTTAGT
JMFF019H22+ GGAACTGAAAAACGGAGTTGAGAATTGAAGAAGAAAGCTTGCGGTTCCATCTAATTTAGT
JMFF051F06+ GGAACTGAAAAACGGAGTTGAGAATTGAAGAAGAAAGCTTGCGGTTCCATCTAATTTAGT
                      ____________________________________________________________
consensus GGAACTGAAAAACGGAGTTGAGAATTGAAGAAGAAAGCTTGCGGTTCCATCTAATTTAGT
 
. : . : . : . : . : . :
JMSF046L04+ AAGCGGCGGCGGTGGTGACCAGGGTGGCGCGCGGTGGAGTGAGAATGAATGCCAGTTGGA
JMFF029E11+ AAGCGGCGGCGGTGGTGACCAGGGTGGCGCGCGGTGGAGTGAGAATGAATGCCAGTTGGA
JMFF025G07+ AAGCGGCGGCGGTGGTGACCAGGGTGGCGCGCGGTGGAGTGAGAATGAATGCCAGTTGGA
JMFF035K09+ AAGCGGCGGCGGTGGTGACCAGGGTGGCGCGCGGTGGAGTGAGAATGAATGCCAGTTGGA
JMSF017E23+ AAGCGGCGGCGGTGGTGACCAGGGTGGCGCGCGGTGGAGTGAGAATGAATGCCAGTTGGA
JMFF036P21+ AAGCGGCGGCGGTGGTGACCAGGGTGGCGCGCGGTGGAGTGAGAATGAATGCCAGTTGGA
JMSF003G07+ AAGCGGCGGCGGTGGTGACCAGGGTGGCGCGCGGTGGAGTGAGAATGAATGCCAGTTGGA
JMFF037I23+ AAGCGGCGGCGGTGGTGACCAGGGTGGCGCGCGGTGGAGTGAGAATGAATGCCAGTTGGA
JMFF037J11+ AAGCGGCGGCGGTGGTGACCAGGGTGGCGCGCGGTGGAGTGAGAATGAATGCCAGTTGGA
JMFF019H22+ AAGCGGCGGCGGTGGTGACCAGGGTGGCGCGCGGTGGAGTGAGAATGAATGCCAGTTGGA
JMFF051F06+ AAGCGGCGGCGGTGGTGACCAGGGTGGCGCGCGGTGGAGTGAGAATGAATGCCAGTTGGA
                      ____________________________________________________________
consensus AAGCGGCGGCGGTGGTGACCAGGGTGGCGCGCGGTGGAGTGAGAATGAATGCCAGTTGGA
 
. : . : . : . : . : . :
JMSF046L04+ ATGT
JMFF029E11+ ATGTGGATGAACACTGCTCTGCTCACAAGTGAAGTAAAGGAGGAGTAGAGCAC
JMFF025G07+ ATGTGGATGAACACTGCTCTGCTCACAAGTGAAGTAAAGGAGGAGTAGAGC
JMFF035K09+ ATGTGGATGAACACTGCTCTGCTCACAAGTGAAGTAAAGGAGGAGTAGAGCAC
JMSF017E23+ ATGTGGAT
JMFF036P21+ ATGTGGAT
JMSF003G07+ ATGTGGATGAACACTGCTCTGCTCACAAGTGAAGTAAAGGAGGAGTAGAGCAC
JMFF037I23+ ATGTGGATGAACACT
JMFF037J11+ ATGTGGATGAACACT
JMFF019H22+ ATGTGGATGAACACTGCTCTGCTCACAAGTGAAGTAAAGGAGGAGTAGAGCAC
JMFF051F06+ ATGTGGATGAACACTGCTCTGCTCACAAGTGAAGTAAAGGAGGAGTAGAGCACAGAGACC
                      ____________________________________________________________
consensus ATGTGGATGAACACTGCTCTGCTCACAAGTGAAGTAAAGGAGGAGTAGAGCACAGAGACC