Previous Contig 002194:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023P04Sequence414002194 (8)gb:AE016959_10225071e-26Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02422002194 (8)gb:AE016959_10225071e-26Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMFF051E10Sequence488002194 (8)gb:AE016959_10225071e-26Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02473002194 (8)gb:AE016959_10225071e-26Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMFN017M05Sequence471002194 (8)gb:AE016959_10225072e-26Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMFN018A01Sequence437002194 (8)gb:AE016959_10225071e-08Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMSF034B05Sequence497002194 (8)gb:AE016959_10225072e-26Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02436002194 (8)gb:AE016959_10225071e-26Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF051E10- CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTTAAGCAGGTA
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTTAAGCAGGTA
 
. : . : . : . : . : . :
JMSF034B05+ TAATTAATATTAAAATGGAAACAGTAATTAAGTTAACAGAGTTCAACTTCTGGCAT
rJMFF051E10- GAATTAATTAATATTAAAATGGAAACAGAAATTAAGTTAACAGAGTTCAATTTCTAGCAT
rJMFF023P04- CTAGCAT
JMFF023P04+ TAAGTTAACAGAGTTCAATTTCTAGCAT
rJMSF034B05- GAGTTCAACTTCTGGCAT
JMFN017M05+ TAATTAATATTAAAATGGAAACAGTAATTAAGTTAACAGAGTTCAACTTCTGGCAT
JMFF051E10+ TAATTAATATTAAAATGGAAACAGAAATTAAGTTAACAGAGTTCAATTTCTAGCAT
                      ____________________________________________________________
consensus GAATTAATTAATATTAAAATGGAAACAGAAATTAAGTTAACAGAGTTCAATTTCTAGCAT
 
. : . : . : . : . : . :
JMSF034B05+ ATAAGCAATATCCAAACTCCAGAGAAACCTAGCTCCAGGGCCTAACGTTTGGCAATT---
rJMFF051E10- ATGATCAATATCCGAACTCAAGAAAACCCTAGCTCTAGGGCACAACGTTTAGCAATTTAA
rJMFF023P04- ATGATCAATATCCGAACTCAAGAAAACCCTAGCTCTAGGGCACAACGTTTAGCAATTTAA
JMFF023P04+ ATGATCAATATCCGAACTCAAGAAAACCCTAGCTCTAGGGCACAACGTTTAGCAATTTAA
rJMSF034B05- ATAAGCAATATCCAAACTCCAGAGAAACCTAGCTCCAGGGCCTAACGTTTGGCAATT---
JMFN017M05+ ATAAGCAATATCCAAACTCCAGAGAAACCTAGCTCCAGGGCCTAACGTTTGGCAATT---
JMFF051E10+ ATGATCAATATCCGAACTCAAGAAAACCCTAGCTCTAGGGCACAACGTTTAGCAATTTAA
                      ____________________________________________________________
consensus ATGATCAATATCCGAACTCAAGAAAACCCTAGCTCTAGGGCACAACGTTTAGCAATTTAA
 
. : . : . : . : . : . :
JMSF034B05+ ---TAAAATTACAAAAACTAAGGAAAATTGATTCTTCGAATCAGTGTTTTAATTCCATAA
JMFN018A01+ AATCAGTGTTTTCATTCCACAT
rJMFF051E10- AACTAAAATTACAAAAACTAAGGAAAATTGAATCTTGGAATCAGTGTTTTAATTCCATAA
rJMFF023P04- AACTAAAATTACAAAAACTAAGGAAAATTGAATCTTGGAATCAGTGTTTTAATTCCATAA
JMFF023P04+ AACTAAAATTACAAAAACTAAGGAAAATTGAATCTTGGAATCAGTGTTTTAATTCCATAA
rJMSF034B05- ---TAAAATTACAAAAACTAAGGAAAATTGATTCTTCGAATCAGTGTTTTAATTCCATAA
JMFN017M05+ ---TAAAATTACAAAAACTAAGGAAAATTGATTCTTCGAATCAGTGTTTTAATTCCATAA
JMFF051E10+ AACTAAAATTACAAAAACTAAGGAAAATTGAATCTTGGAATCAGTGTTTTAATTCCATAA
                      ____________________________________________________________
consensus AACTAAAATTACAAAAACTAAGGAAAATTGAATCTTGGAATCAGTGTTTTAATTCCATAA
 
. : . : . : . : . : . :
JMSF034B05+ CGCTC-TTGATCTCGGGGGCATAGAGGCCATAGACGACGGCCTGACGTTTGGCAATCTCG
JMFN018A01+ CGCTCATTGATCTTGCAGGCATAGAGGCCATAGTTTACGGCCTAACGTTTGGCAATCTTG
rJMFF051E10- CGCTC-TTGATCTTGGAGGCATAGAGGCCATAGACGACGGCCTGACGTTTGGCAATCTCG
rJMFF023P04- CGCTC-TTGATCTTGGAGGCATAGAGGCCATAGACGACGGCCTGACGTTTGGCAATCTCG
JMFF023P04+ CGCTC-TTGATCTTGGAGGCATAGAGGCCATAGACGACGGCCTGACGTTTGGCAATCTCG
rJMSF034B05- CGCTC-TTGATCTCGGGGGCATAGAGGCCATAGACGACGGCCTGACGTTTGGCAATCTCG
JMFN017M05+ CGCTC-TTGATCTCGGGGGCATAGAGGCCATAGACGACGGCCTGACGTTTGGCAATCTCG
JMFF051E10+ CGCTC-TTGATCTTGGAGGCATAGAGGCCATAGACGACGGCCTGACGTTTGGCAATCTCG
                      ____________________________________________________________
consensus CGCTC-TTGATCTTGGAGGCATAGAGGCCATAGACGACGGCCTGACGTTTGGCAATCTCG
 
. : . : . : . : . : . :
JMSF034B05+ AGCTGTGCCTTTCCATCTGAGATGGCGGCGGCAACCAGAGACGAGTCTGAGAGGGCCTTG
JMFN018A01+ AGCTGTGCCTTTCCATGTGAGAAGGCGCCTTCAACCAGAGAGCAGTTTGATAGGGCCTTG
rJMFF051E10- AGCTGTGCCTTTCCATCTGAGAAGGCGGCTGCAACCAGAGACGAGTTTGAGAGGGCCTTG
rJMFF023P04- AGCTGTGCCTTTCCATCTGAGAAGGCGGCTGCAACCAGAGACGAGTTTGAGAGGGCCTTG
JMFF023P04+ AGCTGTGCCTTTCCATCTGAGAAGGCGGCTGCAACCAGAGACGAGTTTGAGAGGGCCTTG
rJMSF034B05- AGCTGTGCCTTTCCATCTGAGATGGCGGCGGCAACCAGAGACGAGTCTGAGAGGGCCTTG
JMFN017M05+ AGCTGTGCCTTTCCATCTGAGATGGCGGCGGCAACCAGAGACGAGTCTGAGAGGGCCTTG
JMFF051E10+ AGCTGTGCCTTTCCATCTGAGAAGGCGGCTGCAACCAGAGACGAGTTTGAGAGGGCCTTG
                      ____________________________________________________________
consensus AGCTGTGCCTTTCCATCTGAGAAGGCGGCTGCAACCAGAGACGAGTTTGAGAGGGCCTTG
 
. : . : . : . : . : . :
JMSF034B05+ TTCTGCCGGAAGGCGTCAACGGTACGGCGCTTGGTGTACTCTCG
JMFN018A01+ TTATGGCGGAAGGCGTCTATGGTACGGCGCGTGGTGTACT
rJMFF051E10- TTCTGGCGGAAGGCGTCAATGGTACGGCGCTTGGTGTACTCTCGTATGTTGTAGTCTGGG
rJMFF023P04- TTCTGGCGGAAGGCGTCAATGGTACGGCGCTTGGTGTACTCTCGTATGTTGTAGTCTGGG
JMFF023P04+ TTCTGGCGGAAGGCGTCAATGGTACGGCGCTTGGTGTACTCTCGTATGTTGTAGTCTGGG
rJMSF034B05- TTCTGCCGGAAGGCGTCAACGGTACGGCGCTTGGTGTACTCTCG
JMFN017M05+ TTCTGCCGGAAGGCGTCAACGGTACGGCGCTTGGTGTACTCTCGTATGTTGTAGTCTGAG
JMFF051E10+ TTCTGGCGGAAGGCGTCAATGGTACGGCGCTTGGTGTACTCTCGTATGTTGTAGTCTGGG
                      ____________________________________________________________
consensus TTCTGGCGGAAGGCGTCAATGGTACGGCGCTTGGTGTACTCTCGTATGTTGTAGTCTGGG
 
. : . : . : . : . : . :
rJMFF051E10- AAGTCACGCGCCGTCCTCAGCAGTGACCGGAACAACGAGAGAACTTGGAGGCGTGATGGC
rJMFF023P04- AAGTCACGCGCCGTCCTCAGCAGTGACCGGAACAACGAGAGAACTTGGAGGCGTGATGGC
JMFF023P04+ AAGTCACGCGCCGTCCTCAGCAGTGACCGGAACAACGAGAGAACTTGGAGGCGTGATGGC
JMFN017M05+ AAGTCACGCGCCGTCCTCAGCAGTGACCGGAACAACGAGAGAACATGGAGGCGTGATGTC
JMFF051E10+ AAGTCACGCGCCGTCCTCAGCAGTGACCGGAACAACGAGAGAACTTGGAGGCGTGATGGC
                      ____________________________________________________________
consensus AAGTCACGCGCCGTCCTCAGCAGTGACCGGAACAACGAGAGAACTTGGAGGCGTGATGGC
 
. : . : . : . : . : . :
rJMFF051E10- GACGC
rJMFF023P04- GACGCCATTTTTGCTCCTTTCTTCAGATTTTGGAGAGAGAGGCAGCAAC
JMFF023P04+ GACGCCATTTTTGCTCCTTTCTTCAGA
JMFN017M05+ GACGCCATTTTTGGTCCTTTCTTCAGATTTTGGAGAGAGCGGTAGCAAC
JMFF051E10+ GACGCCATTTTTGCTCCTTTCTTCAGATTTTGGAGAGAGAGGCAGCAACGGGCATCAAAT
                      ____________________________________________________________
consensus GACGCCATTTTTGCTCCTTTCTTCAGATTTTGGAGAGAGAGGCAGCAACGGGCATCAAAT