Previous Contig 002192:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051D11Sequence623002192 (2)gb:AF092915_17675736e-28Nicotiana tabacum cytochrome P450-dependent fatty acid hydroxylase (CYP94A4) mRN556011061 (2)gb:AF092916_17675749e-40Nicotiana tabacum cytochrome P450-dependent fatty acid hydroxylase (CYP94A5) mRN
JMSF039K07Sequence656002192 (2)gb:AF092915_17675732e-31Nicotiana tabacum cytochrome P450-dependent fatty acid hydroxylase (CYP94A4) mRN547011061 (2)gb:AF092916_17675749e-39Nicotiana tabacum cytochrome P450-dependent fatty acid hydroxylase (CYP94A5) mRN

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039K07+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
JMSF039K07+ GNCCGAGCATGGCCACCACGTCGAAAGTGAACCGCCGGAGAATATCCTGGAAATCCAAGA
JMFF051D11+ GAGAATATCCTGGAAATCCAAGA
                      ____________________________________________________________
consensus GNCCGAGCATGGCCACCACGTCGAAAGTGAACCGCCGGAGAATATCCTGGAAATCCAAGA
 
. : . : . : . : . : . :
JMSF039K07+ CCGTTTTCTTGTCGGCGGCGTCTGAGAGGAGAGGAAACAGGCGGCCGGAAATCTCCTTCT
JMFF051D11+ CCGTNTTCTTGTCGGCGGCGTCTGAGAGGAGAGGAAACAGGCGGCCGGAAATCTCCTTCT
                      ____________________________________________________________
consensus CCGTTTTCTTGTCGGCGGCGTCTGAGAGGAGAGGAAACAGGCGGCCGGAAATCTCCTTCT
 
. : . : . : . : . : . :
JMSF039K07+ TGGTGATATTCTCGATGAAGCCAATGAAAGACTTGGAGTGAAACTCGGCGCCGTAAAGCA
JMFF051D11+ GGTNGATATTCTCGATGAAGCCAATGAAAGACTTGGAGTGAAACTCGGCGCCGTAAAGCA
                      ____________________________________________________________
consensus TGTTGATATTCTCGATGAAGCCAATGAAAGACTTGGAGTGAAACTCGGCGCCGTAAAGCA
 
. : . : . : . : . : . :
JMSF039K07+ GCCTCTGCTTCTTCCAATACTCCCCGTCGGCGAGGAAAAGGCTCCCGCCGAACAAGTCCA
JMFF051D11+ GCCTCTGCTTCTTCCAATACTCCCCGTCGGCGAGGAAAAGGCTCCCGCCGAACAAGTCCA
                      ____________________________________________________________
consensus GCCTCTGCTTCTTCCAATACTCCCCGTCGGCGAGGAAAAGGCTCCCGCCGAACAAGTCCA
 
. : . : . : . : . : . :
JMSF039K07+ AGAAAGAAACCTCGAAGTTCTTCGACTTGGGGTAATCCTTAAACCTCGTCTTCATTATAT
JMFF051D11+ AGAAAGAAACCTCGAAGTTCTTCGACTTGGGGTAATCCTTAAACCTCGTCTTCATTATAT
                      ____________________________________________________________
consensus AGAAAGAAACCTCGAAGTTCTTCGACTTGGGGTAATCCTTAAACCTCGTCTTCATTATAT
 
. : . : . : . : . : . :
JMSF039K07+ GCTGAATGTTCTTTGGGTTGGCGGTTAGAACCCTCGCCCGGCCGAATGGGAACCGGAGGT
JMFF051D11+ GCTGAATGTTCTTTGGGTTGGCGGTTAGAACCCTCGCCCGGCCGAATGGGAACCGGAGGT
                      ____________________________________________________________
consensus GCTGAATGTTCTTTGGGTTGGCGGTTAGAACCCTCGCCCGGCCGAATGGGAACCGGAGGT
 
. : . : . : . : . : . :
JMSF039K07+ AGAACGTCGACGTCGGACACTTGTGCACAATCTCCGCCGTCCAGTCCAAGATCGTCTTCT
JMFF051D11+ AGAACGTCGACGTCGGACACTTGTGCACAATCTCCGCCGTCCAGTCCAAGATCGTCTTCT
                      ____________________________________________________________
consensus AGAACGTCGACGTCGGACACTTGTGCACAATCTCCGCCGTCCAGTCCAAGATCGTCTTCT
 
. : . : . : . : . : . :
JMSF039K07+ GGTTCTTAAGCATGGAAAAGATATGGCCGAACATGGGGTACGATCTTGGGAGGCCACTTT
JMFF051D11+ GGTTCTTAAGCATGGAAAAGATATGGCCGAACATGGGGTACGATCTTGGGAGGCCACTTT
                      ____________________________________________________________
consensus GGTTCTTAAGCATGGAAAAGATATGGCCGAACATGGGGTACGATCTTGGGAGGCCACTTT
 
. : . : . : . : . : . :
JMSF039K07+ TGGGAGCCGGCACCAACCTAATATATACGAGGAAGAACACAACAAGGCAGAACAGCCAAG
JMFF051D11+ TGGGAGCCGGCACCAACCTAATATATACGAGGAAGAACACAACAAGGCAGAACAGCCAAG
                      ____________________________________________________________
consensus TGGGAGCCGGCACCAACCTAATATATACGAGGAAGAACACAACAAGGCAGAACAGCCAAG
 
. : . : . : . : . : . :
JMSF039K07+ CACATAGGATTTGGATAATGTCTTCCATGGCTGAACAGTGCGAAGTCGTTTGTTCGATTC
JMFF051D11+ CACATAGGATTTGGATAATGTCTTCCATGGCTGAACAGTGCGAAGTCGTTTGTTCGATTC
                      ____________________________________________________________
consensus CACATAGGATTTGGATAATGTCTTCCATGGCTGAACAGTGCGAAGTCGTTTGTTCGATTC
 
. : . : . : . : . : . :
JMSF039K07+ AGCACCGCCGGCGGCCAAGATCAGACTAGCTTAGCTTGTGTTTCCGCTCTCTGCC
JMFF051D11+ AGCACCGCCGGCGGCCAAGATCAGACTAGCTTAGCTTGTGTTTCCGCTCTCTGCCTCCTA
                      ____________________________________________________________
consensus AGCACCGCCGGCGGCCAAGATCAGACTAGCTTAGCTTGTGTTTCCGCTCTCTGCCTCCTA