Previous Contig 002184:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002I22Sequence488002184 (6)gb:NTA131836_16912596e-46Nicotiana tabacum acs2 gene, exons 1-4.>gb:NTAJ5002_1691456 Nicotiana tabacum mR743009445 (4)gb:AF057563_17648341e-81Nicotiana glutinosa 1-aminocyclopropane-1-carboxylate synthase (ACS2) mRNA, comp
JMFF020F11Sequence581002184 (6)gb:NTA131836_16912594e-62Nicotiana tabacum acs2 gene, exons 1-4.>gb:NTAJ5002_1691456 Nicotiana tabacum mR734009445 (4)gb:AF057563_17648341e-81Nicotiana glutinosa 1-aminocyclopropane-1-carboxylate synthase (ACS2) mRNA, comp
JMFF021F23Sequence547002184 (6)gb:AY426755_16056881e-63Nicotiana attenuata ACC synthase ACS3b (Acs3b) mRNA, complete cds.566021139
JMFF026G16Sequence517002184 (6)gb:NTA131836_16912592e-50Nicotiana tabacum acs2 gene, exons 1-4.>gb:NTAJ5002_1691456 Nicotiana tabacum mR828009445 (4)gb:AF057563_17648341e-87Nicotiana glutinosa 1-aminocyclopropane-1-carboxylate synthase (ACS2) mRNA, comp
JMFF030G19Sequence446002184 (6)gb:NTA131836_16912599e-39Nicotiana tabacum acs2 gene, exons 1-4.>gb:NTAJ5002_1691456 Nicotiana tabacum mR638009445 (4)gb:AF057563_17648342e-65Nicotiana glutinosa 1-aminocyclopropane-1-carboxylate synthase (ACS2) mRNA, comp
JMFF051A19Sequence635002184 (6)gb:NTA131836_16912594e-68Nicotiana tabacum acs2 gene, exons 1-4.>gb:NTAJ5002_1691456 Nicotiana tabacum mR

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF051A19+ TCAAAACCAGGATAATATGGAGTGGGACCAAAAAT
                      ____________________________________________________________
consensus TCAAAACCAGGATAATATGGAGTGGGACCAAAAAT
 
. : . : . : . : . : . :
JMFF020F11+ CCAAACAGAAGGCCAGTGCTTCATGAGCTCCGGTGGCACCTCCG
JMFF021F23+ CCAAACAGAAGGCCAGTATTTCATGAGCTCCGGTGGCACCTCCG
JMFF051A19+ GCTTCGCCGGGATTCACCAAACAGAAGGCCAGTGCTTCATGAGCTCCGGTGGCACCTCCG
                      ____________________________________________________________
consensus GCTTCGCCGGGATTCACCAAACAGAAGGCCAGTGCTTCATGAGCTCCGGTGGCACCTCCG
 
. : . : . : . : . : . :
JMFF026G16+ GTCGAATTTCACTGTGTCTCCCCTTACTTTCTCCATGAAT
JMFF020F11+ CTCATAACGATCCTGTCGGGGTCGAATTTCACTGTGTCTCCCCTTACTTTCTCCATGAAT
JMFF002I22+ TCTCCATGAAT
JMFF021F23+ CTCATAACGATCCTATCCGGATCAAATTTCACTGTGTCTCCCCTCACTTTCTCCATGAAT
JMFF051A19+ CTCATAACGATCCTGTCGGGGTCGAATTTCACTGTGTCTCCCCTTACTTTCTCCATGAAT
                      ____________________________________________________________
consensus CTCATAACGATCCTGTCGGGGTCGAATTTCACTGTGTCTCCCCTTACTTTCTCCATGAAT
 
. : . : . : . : . : . :
JMFF026G16+ CTTGCAACAGCACATCTAAATTCCGGCAATCCATGGTAGTCTTGATAAATAGCAATATCT
JMFF020F11+ CTTGCAACAGCACATCTAAATTCCGGCAATCCATGGTAGTCTTGATAAATAGCAATATCT
JMFF030G19+ CATGGTAGTCTTGATAAATAGCAATATCT
JMFF002I22+ CTTGCAACAGCACATCTAAATTCCGGCAATCCATGGTAGTCTTGATAAATAGCAATATCT
JMFF021F23+ CTTGCCACAGCAGTTCTGAATTCCGGCAATCCATGGTAGTCTTGATAAATAGCAATATCT
JMFF051A19+ CTTGCAACAGCACATCTAAATTCCGGCAATCCATGGTAGTCTTGATAAATAGCAATATCT
                      ____________________________________________________________
consensus CTTGCAACAGCACATCTAAATTCCGGCAATCCATGGTAGTCTTGATAAATAGCAATATCT
 
. : . : . : . : . : . :
JMFF026G16+ TTAAACTCTTCTGCTCCTTGGGGCGTGCAAATGGAGGCTTTGGGGTTGTTCAACACCCAC
JMFF020F11+ TTAAACTCTTCTGCTCCTTGGGGCGTGCAAATGGAGGCTTTGGGGTTGTTCAACACCCAC
JMFF030G19+ TTAAACTCTTCTGCTCCTTGGGGCGTGCAAATGGAGGCTTTGGGGTTGTTCAACACCCAC
JMFF002I22+ TTAAACTCTTCTGCTCCTTGGGGCGTGCAAATGGAGGCTTTGGGGTTGTTCAACACCCAC
JMFF021F23+ TTGAACTCTTCTGCCCCTTGGGGCGTACAAATGGAGGCTTTGGGGTTATTCAATACCCAG
JMFF051A19+ TTAAACTCTTCTGCTCCTTGGGGCGTGCAAATGGAGGCTTTGGGGTTGTTCAACACCCAC
                      ____________________________________________________________
consensus TTAAACTCTTCTGCTCCTTGGGGCGTGCAAATGGAGGCTTTGGGGTTGTTCAACACCCAC
 
. : . : . : . : . : . :
JMFF026G16+ TTCTTAATCAAATCAAAGCAGAGCTGGTTTTCTGCTAAGCCCATTTGGATAACACCCTGA
JMFF020F11+ TTCTTAATCAAATCAAAGCAGAGCTGGTTTTCTGCTAAGCCCATTTGGATAACACCCTGA
JMFF030G19+ TTCTTAATCAAATCAAAGCAGAGCTGGTTTTCTGCTAAGCCCATTTGGATAACACCCTGA
JMFF002I22+ TTCTTAATCAAATCAAAGCAGAGCTGGTTTTCTGCTAAGCCCATTTGGATAACACCCTGA
JMFF021F23+ TTCTTAATCAAATCAAAGCAGAGCTGGTTTTCTGCTAAGCCCATCTGGATAACACCCTGA
JMFF051A19+ TTCTTAATCAAATCAAAGCAGAGCTGGTTTTCTGCTAAGCCCATTTGGATAACACCCTGA
                      ____________________________________________________________
consensus TTCTTAATCAAATCAAAGCAGAGCTGGTTTTCTGCTAAGCCCATTTGGATAACACCCTGA
 
. : . : . : . : . : . :
JMFF026G16+ GGATTATGTTTGGGATGGAAAGGGTCATTATCATAAGCCTTCCAACCATCAAAGTATGCA
JMFF020F11+ GGATTATGTTTGGGATGGAAAGGGTCATTATCATAAGCCTTCCAACCATCAAAGTATGCA
JMFF030G19+ GGATTATGTTTGGGATGGAAAGGGTCATTATCATAAGCCTTCCAACCATCAAAGTATGCA
JMFF002I22+ GGATTATGTTTGGGATGGAAAGGGTCATTATCATAAGCCTTCCAACCATCAAAGTATGCA
JMFF021F23+ GGATTATGTTTGGGATGGAAAGGGTTATTATCATAAGCCTTCCAACCATCAAAGTAGGCC
JMFF051A19+ GGATTATGTTTGGGATGGAAAGGGTCATTATCATAAGCCTTCCAACCATCAAAGTATGCA
                      ____________________________________________________________
consensus GGATTATGTTTGGGATGGAAAGGGTCATTATCATAAGCCTTCCAACCATCAAAGTATGCA
 
. : . : . : . : . : . :
JMFF026G16+ GAGTTTTCTCCGTGTCCATTGTTGGTAGCAATTTTGGACAAAACTTCTGTGTGTTTCATG
JMFF020F11+ GAGTTTTCTCCGTGTCCATTGTTGGTAGCAATTTTGGACAAAACTTCTGTGTGTTTCATG
JMFF030G19+ GAGTTTTCTCCGTGTCCATTGTTGGTAGCAATTTTGGACAAAACTTCTGTGTGTTTCATG
JMFF002I22+ GAGTTTTCTCCGTGTCCATTGTTGGTAGCAATTTTGGACAAAACTTCTGTGTGTTTCATG
JMFF021F23+ GAGTTTTCTCCGTGTCCATCGTTGGTAGCAATTTTGGACAA
JMFF051A19+ GAGTTTTCTCCGTGTCCATTGTTGGTAGCAATTTTGGACAAAACTTCTGTGTGTTTCATG
                      ____________________________________________________________
consensus GAGTTTTCTCCGTGTCCATTGTTGGTAGCAATTTTGGACAAAACTTCTGTGTGTTTCATG
 
. : . : . : . : . : . :
JMFF026G16+ GTCTTCAAATCCATATGATGATATGATGTGATGTTCAAAGAAGGATTCTGAAAAGAAAGA
JMFF020F11+ GTCTTCAAATCCATATGATGATATGATGTGATGTTCAAAGAAGGATTCTGAAAAGAAAGA
JMFF030G19+ GTCTTCAAATCCATATGATGATATGATGTGATGTTCAAAGAAGGATTCTGAAAAGAAAGA
JMFF002I22+ GTCTTCAAATCCATATGATGATATGATGTGATGTTCAAAGAAGGATTCTGAAAAGAAAGA
JMFF051A19+ GTCTTCAAATCCATATGATGATATGATGTGATGTTCAAAGAAGGATTCTGAAAAGAAAGA
                      ____________________________________________________________
consensus GTCTTCAAATCCATATGATGATATGATGTGATGTTCAAAGAAGGATTCTGAAAAGAAAGA
 
. : . : . : . : . : . :
JMFF026G16+ AAATGATGTGTTTTTCTCCTGCGTATGTAATTATATATGCTGAAATGACAATAAGTGTAT
JMFF020F11+ AAATGATGTGTTTTTCTCCTGCGTATGTAATTATATATGCTGAAATGACAATAAGTGTAT
JMFF030G19+ AAATGATGTGTTTTTCTCCTGCGTATGTAATTATATATGCTGAAATGACAATAAGTGTAT
JMFF002I22+ AAATGATGTGTTTTTCTCCTGCGTATGTAATTATATATGCTGAAATGACAATAAGTGTAT
JMFF051A19+ AAATGATGTGTTTTTCTCCTGCGTATGTAATTATATATGCTGAAATGACAATAAGTGTAT
                      ____________________________________________________________
consensus AAATGATGTGTTTTTCTCCTGCGTATGTAATTATATATGCTGAAATGACAATAAGTGTAT
 
. : . : . : . : . : . :
JMFF026G16+ GTTCAGGTTTTGGGTGAGATCGAGAGCGAGTATGTAGTAGAATGTTTTGTGTGT
JMFF020F11+ GTTCAGGTTTTGGGTGAGATCGAGAGCGAGTATGTAGTAGAATGTTTTGTGTGT
JMFF030G19+ GTTCAGGTTTTGGGTGAGATCGAGAGCGAGTATGTAGTAGAATGTTTTGTGTGT
JMFF002I22+ GTTCAGGTTTTGGGTGAGATCGAGAGCGAGTATGTAGTAGAATGTTTTGTGTGT
JMFF051A19+ GTTCAGGTTTTGGGTGAGATCGAGAGCGAGTATGTAGTAGAATGTTTTGTGTGTGACCGG
                      ____________________________________________________________
consensus GTTCAGGTTTTGGGTGAGATCGAGAGCGAGTATGTAGTAGAATGTTTTGTGTGTGACCGG