Previous Contig 002180:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051A04Sequence616002180 (2)412021920
JMFS121F09Sequence564002180 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS121F09+ CTCTCAAGATAATCCGGGAGCTTCAAGCAAATC
                      ____________________________________________________________
consensus CTCTCAAGATAATCCGGGAGCTTCAAGCAAATC
 
. : . : . : . : . : . :
JMFS121F09+ AGAATTAAGTAAAATACAGCTAATCCCAACAAAATATGTGACAACTTGAATCTCCTCATG
JMFF051A04+ TGAATCTCCTCATG
                      ____________________________________________________________
consensus AGAATTAAGTAAAATACAGCTAATCCCAACAAAATATGTGACAACTTGAATCTCCTCATG
 
. : . : . : . : . : . :
JMFS121F09+ CCTGGAACCTCATTTTTCAATCTCTTCATTGCTATAAATTTAGAAATTACACGAAACTCA
JMFF051A04+ CTGGGAACCTCA-TTTTCAATCTCTTCATTGCTATAAATTTAGAAATTACACGAAACTCA
                      ____________________________________________________________
consensus CTTGGAACCTCATTTTTCAATCTCTTCATTGCTATAAATTTAGAAATTACACGAAACTCA
 
. : . : . : . : . : . :
JMFS121F09+ CACCCTATGCTGCAGATTACTCCGACCCATTTCTTATAAACACCGCAACAATCAAACTAC
JMFF051A04+ CACCCTATGCTGCAGATTACTCCGACCCATTTCTTATAAACACCGCAACAATCAAACTAC
                      ____________________________________________________________
consensus CACCCTATGCTGCAGATTACTCCGACCCATTTCTTATAAACACCGCAACAATCAAACTAC
 
. : . : . : . : . : . :
JMFS121F09+ ACACTCTAAATCCAAAATTTAAGATTGCCCAAATACTCGGCCTTCCAAATAAATCACTCA
JMFF051A04+ ACACTCTAAATCCAAAATTTAAGATTGCCCAAATACTCGGCCTTCCAAATAAATCACTCA
                      ____________________________________________________________
consensus ACACTCTAAATCCAAAATTTAAGATTGCCCAAATACTCGGCCTTCCAAATAAATCACTCA
 
. : . : . : . : . : . :
JMFS121F09+ AAACTTCAATAAACGAAAATCATTATCAGTACAATAAAAAAAAAAATCCCAGACCTGAAA
JMFF051A04+ AAACTTCAATAAACGAAAATCATTATCAGTACAATA--AAAAAAAATCCCAGACCTGAAA
                      ____________________________________________________________
consensus AAACTTCAATAAACGAAAATCATTATCAGTACAATAAAAAAAAAAATCCCAGACCTGAAA
 
. : . : . : . : . : . :
JMFS121F09+ TCCTACTGTCATAACCTTAACAACAAAACACAATCAAATTCACTGCGATATGGATGCGCA
JMFF051A04+ TCCTACTGTCATAACCTTAACAACAAAACACAATCAAATTCACTGCGATATGGATGCGCA
                      ____________________________________________________________
consensus TCCTACTGTCATAACCTTAACAACAAAACACAATCAAATTCACTGCGATATGGATGCGCA
 
. : . : . : . : . : . :
JMFS121F09+ ACGGAGTGATCTAGAAGTGGTAAAAAAAATGATGAGTTGTAACTAATAAACCATCACTAT
JMFF051A04+ ACGGAGTGATCTAGAAGTGGTAAAAAAAATGATGAGTTGTAACTAATAAACCATCACTAT
                      ____________________________________________________________
consensus ACGGAGTGATCTAGAAGTGGTAAAAAAAATGATGAGTTGTAACTAATAAACCATCACTAT
 
. : . : . : . : . : . :
JMFS121F09+ ACTGAAATATATGGAATCTGTGCCCAGAATACTGAAAACAAACCGAAAAAATCGATCTTG
JMFF051A04+ ACTGAAATATATGGAATCTGTGCCCAGAATACTGAAAACAAACCGAAAAAATCGATCTTG
                      ____________________________________________________________
consensus ACTGAAATATATGGAATCTGTGCCCAGAATACTGAAAACAAACCGAAAAAATCGATCTTG
 
. : . : . : . : . : . :
JMFS121F09+ GATGCGTTTAGAACGAGACGCAAGTGAGAGAAATCCAGTTTGCTGAAGAAA
JMFF051A04+ GATGCGTTTAGAACGAGACGCAAGTGAGAGAAATCCAGTTTGCTGAAGAAACGCAGCCTT
                      ____________________________________________________________
consensus GATGCGTTTAGAACGAGACGCAAGTGAGAGAAATCCAGTTTGCTGAAGAAACGCAGCCTT
 
. : . : . : . : . : . :
JMFF051A04+ GTCTGGAGGCGAGTCAATGCATGTATTCTGGGACTGAAAACCTTTCAGCCTTGCAATTGG
                      ____________________________________________________________
consensus GTCTGGAGGCGAGTCAATGCATGTATTCTGGGACTGAAAACCTTTCAGCCTTGCAATTGG
 
. : . : . : . : . : . :
JMFF051A04+ ACGAGGGAAATCAGGGAAACTCTTTTGTTTCATAAATCTTGACTCATTTTCTTCCCCCTC
                      ____________________________________________________________
consensus ACGAGGGAAATCAGGGAAACTCTTTTGTTTCATAAATCTTGACTCATTTTCTTCCCCCTC