Previous Contig 002173:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016J01Sequence604002173 (15)gb:TOBTUFA_17255704e-56N. sylvestris tufA gene for chloroplast elongation factor TuA (EF-TuA), partial 774002173 (15)sp|P41342|EFTU_TOBAC4e-99Elongation factor Tu, chloroplast precursor (EF-Tu).>pir|S36183|S36183 translati
JMFF018F08Sequence578002173 (15)gb:TOBTUFA_17255705e-49N. sylvestris tufA gene for chloroplast elongation factor TuA (EF-TuA), partial 727002173 (15)sp|P41342|EFTU_TOBAC2e-93Elongation factor Tu, chloroplast precursor (EF-Tu).>pir|S36183|S36183 translati
JMFF022M19Sequence759002173 (15)sp|P41342|EFTU_TOBACe-111Elongation factor Tu, chloroplast precursor (EF-Tu).>pir|S36183|S36183 translati
JMFF025M03Sequence479002173 (15)gb:TOBTUFA_17255701e-30N. sylvestris tufA gene for chloroplast elongation factor TuA (EF-TuA), partial 773002173 (15)sp|P41342|EFTU_TOBACe-102Elongation factor Tu, chloroplast precursor (EF-Tu).>pir|S36183|S36183 translati
JMFF041L14Sequence655002173 (15)gb:TOBTUFA_17255701e-65N. sylvestris tufA gene for chloroplast elongation factor TuA (EF-TuA), partial 554002173 (15)sp|P46280|EFT2_SOYBN4e-43Elongation factor Tu, chloroplast precursor (EF-Tu).>pir|S60659|S60659 translati
JMFF050M24Sequence598002173 (15)gb:TOBTUFA_17255701e-54N. sylvestris tufA gene for chloroplast elongation factor TuA (EF-TuA), partial 561002173 (15)sp|P41342|EFTU_TOBAC1e-69Elongation factor Tu, chloroplast precursor (EF-Tu).>pir|S36183|S36183 translati
JMFN029K12Sequence505002173 (15)sp|P46280|EFT2_SOYBN3e-55Elongation factor Tu, chloroplast precursor (EF-Tu).>pir|S60659|S60659 translati
JMFS147C03Sequence620002173 (15)gb:TOBTUFA_17255701e-75N. sylvestris tufA gene for chloroplast elongation factor TuA (EF-TuA), partial
JMSF022D19Sequence641002173 (15)gb:TOBTUFA_17255701e-75N. sylvestris tufA gene for chloroplast elongation factor TuA (EF-TuA), partial 769002173 (15)sp|P41342|EFTU_TOBACe-126Elongation factor Tu, chloroplast precursor (EF-Tu).>pir|S36183|S36183 translati

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF041L14- CCCTGGAGAGTT
                      ____________________________________________________________
consensus CCCTGGAGAGTT
 
. : . : . : . : . : . :
rJMFF041L14- TTTTTTTTTTTTTCXXXXXXXXXXXXXXXXXXXXXXXXXXXXAACAAGCAAGCACACATT
                      ____________________________________________________________
consensus TTTTTTTTTTTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAAGCAAGCACACATT
 
. : . : . : . : . : . :
rJMFF041L14- CTTTAGAAAATCTTCAACAATCAGAAGTAAAATATAAAGCATGTGAAGTAGAGCATTAGC
JMFN029K12+ AAAGCATGTGAAGTAGAGCATTAGC
rJMFF018F08- AAAGCATGTGAAGTAGAGCATTAGC
rJMFF025M03- ATGTGAAGTAGAGCATTAGC
rJMFF016J01- AAAGCATGTGAAGTAGAGCATTAGC
                      ____________________________________________________________
consensus CTTTAGAAAATCTTCAACAATCAGAAGTAAAATATAAAGCATGTGAAGTAGAGCATTAGC
 
. : . : . : . : . : . :
rJMFF041L14- CATTTAGTGACAACATGAATTCTCCAACTAAACTAGAAGGTCTAGCACATAATAAAAGCA
JMFN029K12+ CATTTAGTGACAACATGAATTCTCCAACTAAACTAGAAGGTCTAGCACATAATAAAAGCA
rJMFF018F08- CATTTAGTGACAACATGAATTCTCCAACTAAA--AGAAGGTCTAGCACATAATAAAAGCA
rJMFF025M03- CATTTAGTGACAACATGAATTCTCCAACTAAACTAGAAGGTCTAGCACATAATAAAAGCA
rJMFF050M24- GTGACAACATGAATTCTCCAACTAAACTAGAAGGTCTAGCACATAATAAAAGCA
rJMFF016J01- CATTTAGTGACAACATGAATTCTCCAACTAAACTAGAAGGTCTAGCACATAATAAAAGCA
rJMFF022M19- ACTAGAAGGTCTAGCACATAATAAAAGCA
                      ____________________________________________________________
consensus CATTTAGTGACAACATGAATTCTCCAACTAAACTAGAAGGTCTAGCACATAATAAAAGCA
 
. : . : . : . : . : . :
rJMFF041L14- AACAAAAAGCTTGAATATATGATGATAACAGTTTGAAGATATTGCACAAAAATGCAGAGA
JMFN029K12+ AACAAAAAGCTTGAATATATGATGATAACAGTTTGAAGATATTGCACAAAAATGCAGAGA
rJMFF018F08- AACAAAAAGCTTGAATATATGATGATAACAGTTTGAAGATATTGCACAAAAATGCAGAGA
rJMFF025M03- AACAAAAAGCTTGAATATATGATGATAACAGTTTGAAGATATTGCACAAAAATGCAGAGA
rJMFF050M24- AACAAAAAGCTTGAATATATGATGATAACAGTTTGAAGATATTGCACAAAAATGCAGAGA
rJMFF016J01- AACAAAAAGCTTGAATATATGATGATAACAGTTTGAAGATATTGCACAAAAATGCAGAGA
rJMFF022M19- AACAAAAAGCTTGAATATATGATGATAACAGTTTGAAGATATTGCACAAAAATGCAGAGA
rJMSF022D19- AAAAATGCAGAGA
                      ____________________________________________________________
consensus AACAAAAAGCTTGAATATATGATGATAACAGTTTGAAGATATTGCACAAAAATGCAGAGA
 
. : . : . : . : . : . :
rJMFF041L14- CAATGTTAGGTTGATCACTCGAGAATTTTCTGAATGACACCAGCCCCGACTGTCTTTCCT
JMFN029K12+ CAATGTTAGGTTGATCACTCGAGAATTTTCTGAATGACACCAGCCCCGACTGTCTTTCCT
rJMFF018F08- CAATGTTAGGTTGATCACTCGAGAATTTTCTGAATGACACCAGCCCCGACTGTCTTTCCT
rJMFF025M03- CAATGTTAGGTTGATCACTCGAGAATTTTCTGAATGACACCAGCCCCGACTGTCTTTCCT
rJMFF050M24- CAATGTTAGGTTGATCACTCGAGAATTTTCTGAATGACACCAGCCCCGACTGTCTTTCCT
rJMFF016J01- CAATGTTAGGTTGATCACTCGAGAATTTTCTGAATGACACCAGCCCCGACTGTCTTTCCT
rJMFF022M19- CAATGTTAGGTTGATCACTCGAGAATTTTCTGAATGACACCAGCCCCGACTGTCTTTCCT
rJMSF022D19- CAATGTTAGGTTGATCACTCGAGAATTTTCTGAATGACACCAGCCCCGACTGTCTTTCCT
                      ____________________________________________________________
consensus CAATGTTAGGTTGATCACTCGAGAATTTTCTGAATGACACCAGCCCCGACTGTCTTTCCT
 
. : . : . : . : . : . :
rJMFF041L14- CCTTCCCGGATAGCAAATCTCATCCCTTGCTCACAAGCAACCGGCATAATGAGCTCCACA
JMFN029K12+ CCTTCCCGGATAGCAAATCTCATCCCTTGCTCACAAGCAACCGGCATAATGAGCTCCACA
rJMFF018F08- CCTTCCCGGATAGCAAATCTCATCCCTTGCTCACAAGCAACCGGCATAATGAGCTCCACA
rJMFF025M03- CCTTCCCGGATAGCAAATCTCATCCCTTGCTCACAAGCAACCGGCATAATGAGCTCCACA
rJMFF050M24- CCTTCCCGGATAGCAAATCTCATCCCTTGCTCACAAGCAACCGGCATAATGAGCTCCACA
rJMFF016J01- CCTTCCCGGATAGCAAATCTCATCCCTTGCTCACAAGCAACCGGCATAATGAGCTCCACA
rJMFF022M19- CCTTCCCGGATAGCAAATCTCATCCCTTGCTCACAAGCAACCGGCATAATGAGCTCCACA
rJMSF022D19- CCTTCCCGGATAGCAAATCTCATCCCTTGCTCACAAGCAACCGGCATAATGAGCTCCACA
                      ____________________________________________________________
consensus CCTTCCCGGATAGCAAATCTCATCCCTTGCTCACAAGCAACCGGCATAATGAGCTCCACA
 
. : . : . : . : . : . :
rJMFF041L14- ACCATTTTCACACGATCCCCGGGCATCACCATCTTCGACTCCTCATCTTTGTCATTCTTA
JMFN029K12+ ACCATTTTCACACGATCCCCGGGCATCACCATCTTCGACTCCTCATCTTTGTCATTCTTA
rJMFF018F08- ACCATTTTCACACGATCCCCGGGCATCACCATCTTCGACTCCTCATCTTTGTCATTCTTA
rJMFF025M03- ACCATTTTCACACGATCCCCGGGCATCACCATCTTCGACTCCTCATCTTTGTCATTCTTA
rJMFF050M24- ACCATTTTCACACGATCCCCGGGCATCACCATCTTCGACTCCTCATCTTTGTCATTCTTA
rJMFF016J01- ACCATTTTCACACGATCCCCGGGCATCACCATCTTCGACTCCTCATCTTTGTCATTCTTA
rJMFF022M19- ACCATTTTCACACGATCCCCGGGCATCACCATCTTCGACTCCTCATCTTTGTCATTCTTA
rJMSF022D19- ACCATTTTCACACGATCCCCGGGCATCACCATCTTCGACTCCTCATCTTTGTCATTCTTA
                      ____________________________________________________________
consensus ACCATTTTCACACGATCCCCGGGCATCACCATCTTCGACTCCTCATCTTTGTCATTCTTA
 
. : . : . : . : . : . :
rJMFF041L14- ATGCCAATCACCTTCCCGGTCACATCAGTTGTCCTCATGTAAAACTGTGGCCTGTAGCCA
JMFN029K12+ ATGCCAATCACCTTCCCGGTCACATCAGTTGTCCTCATGTAGAACTGTGGCCTGTAGCCA
rJMFF018F08- ATGCCAATCACCTTCCCGGTCACATCAGTTGTCCTCATGTAGAACTGTGGCCTGTAGCCA
rJMFF025M03- ATGCCAATCACCTTCCCGGTCACATCAGTTGTCCTCATGTAGAACTGTGGCCTGTAGCCA
rJMFF050M24- ATGCCAATCACCTTCCCGGTCACATCAGTTGTCCTCATGTAGAACTGTGGCCTGTAGCCA
rJMFF016J01- ATGCCAATCACCTTCCCGGTCACATCAGTTGTCCTCATGTAGAACTGTGGCCTGTAGCCA
rJMFF022M19- ATGCCAATCACCTTCCCGGTCACATCAGTTGTCCTCATGTAGAACTGTGGCCTGTAGCCA
rJMSF022D19- ATGCCAATCACCTTCCCGGTCACATCAGTTGTCCTCATGTAGAACTGTGGCCTGTAGCCA
                      ____________________________________________________________
consensus ATGCCAATCACCTTCCCGGTCACATCAGTTGTCCTCATGTAGAACTGTGGCCTGTAGCCA
 
. : . : . : . : . : . :
rJMFF041L14- GAGAAGAACGGGGAGTGCCTCCCGCCTTCCTCCTTCTTAAACACATACACAATCGACTCG
JMFN029K12+ GAGAAGAACGGGGAGTGCCTCCCGCCTTCCTCCTTCTTCAACACATACACAATCGACTCG
rJMFF018F08- GAGAAGAACGGGGAGTGCCTCCCGCCTTCCTCCTTCTTCAACACATACACAATCGACTCG
rJMFF025M03- GAGAAGAACGGGGAGTGCCTCCCGCCTTCCTCCTTCTTCAACACATACACAATCGACTCG
rJMFF050M24- GAGAAGAACGGGGAGTGCCTCCCGCCTTCCTCCTTCTTCAACACATACACAATCGACTCG
rJMFF016J01- GAGAAGAACGGGGAGTGCCTCCCGCCTTCCTCCTTCTTCAACACATACACAATCGACTCG
rJMFF022M19- GAGAAGAACGGGGAGTGCCTCCCGCCTTCCTCCTTCTTCAACACATACACAATCGACTCG
rJMSF022D19- GAGAAGAACGGGGAGTGCCTCCCGCCTTCCTCCTTCTTCAACACATACACAATCGACTCG
JMSF022D19+ TTCAACACATACACAATCGACTCG
                      ____________________________________________________________
consensus GAGAAGAACGGGGAGTGCCTCCCGCCTTCCTCCTTCTTCAACACATACACAATCGACTCG
 
. : . : . : . : . : . :
rJMFF041L14- AA
JMFN029K12+ AACTTGGTGTGGGGAGTGATTGTCCCGGGTTTCGCCAACACCATCCCCCTCTGGATATCT
rJMFF018F08- AACTTGGTGTGGGGAGTGATTGTCCCGGGTTTCGCCAACACCATCCCCCCCTGGATATCT
rJMFF025M03- AACTTGGTGTGGGGAGTGATTGTCCCGGGTTTCGCCAACACCATCCCCCTCTGGATATCT
rJMFF050M24- AACTTGGTGTGGGGAGTGATTGTCCCGGGTTTCGCCAACACCATCCCCCTCTGGATATCT
rJMFF016J01- AACTTGGTGTGGGGAGTGATTGTCCCGGGTTTCGCCAACACCATCCCCCTCTGGATATCT
rJMFF022M19- AACTTGGTGTGGGGAGTGATTGTCCCGGGTTTCGCCAACACCATCCCCCTCTGGATATCT
rJMSF022D19- AACTTGGTGTGGGGAGTGATTGTCCCGGGTTTCGCCAACACCATCCCCCTCTGGATATCT
JMSF022D19+ AACTTGGTGTGGGGAGTGATTGTCCCGGGTTTCGCCAACACCATCCCCCTCTGGATATCT
                      ____________________________________________________________
consensus AACTTGGTGTGGGGAGTGATTGTCCCGGGTTTCGCCAACACCATCCCCCTCTGGATATCT
 
. : . : . : . : . : . :
rJMFF018F08- GCCTTCTGCATACCTCTCAATAACAACCCCA-CATTATCCCCTGCCATTGCATCATCCAA
rJMFF025M03- GCCTTCTGCATACCTCTCAATAACAACCCCA-CATTATCCCCTGCCATTGCATCATCCAA
rJMFF050M24- GCCTTCTGCATACCTCTCAATAACAACCCCA-CATTATCCCCTGCCATTGCATCATCNCA
rJMFF016J01- GCCTTCTGCATACCTCTCAATAACAACCCCA-CATTATCCCCTGCCATTGCATCATCCAA
rJMFF022M19- GCCTTCTGCATACCTCTCAATAACAACCCCA-CATTATCCCCTGCCATTGCATCATCCAA
rJMSF022D19- GCCTTCTGCATACCTCTCAATAACAACCCCA-CATTATCCCCTGCCATTGCATCATCCAA
JMSF022D19+ GCCTTCTGCATACCTCTCAATAACAACCCCACCATTATCCCCTGCCATTGCATCATCCAA
                      ____________________________________________________________
consensus GCCTTCTGCATACCTCTCAATAACAACCCCA-CATTATCCCCTGCCATTGCATCATCCAA
 
. : . : . : . : . : . :
rJMFF018F08- AATCTTCTGAAACATCTCAACCCCAGTCACAGTTGTGCTCCTAGTGTCCTTCAATCCCAC
rJMFF025M03- AATCTTCTGAAACATCTCAACCCCAGTCACAGTTGTGCTCCTAGTGTCCTTCAATCCCAC
rJMFF050M24- AATCTTCTGAAACATCTCAACCCCAGT
rJMFF016J01- AATCTTCTGAAACATCTCAACCCCAGTCACAGTTGTGCTCCTAGTGTCCTTCAATCCCAC
rJMFF022M19- AATCTTCTGAAACATCTCAACCCCAGTCACAGTTGTGCTCCTAGTGTCCTTCAATCCCAC
rJMSF022D19- AATCTTCTGAAACATCTCAACCCCAGTCACAGTTGTGCTCCTAGTGTCCTTCAATCCCAC
JMSF022D19+ AATCTTCTGAAACATCTCAACCCCAGTCACAGTTGTGCTCCTAGTGTCCTTCAATCCCAC
                      ____________________________________________________________
consensus AATCTTCTGAAACATCTCAACCCCAGTCACAGTTGTGCTCCTAGTGTCCTTCAATCCCAC
 
. : . : . : . : . : . :
rJMFF018F08- TAAATCAACAGTGTCCCCAACCTTAACAGTGCCCCTCTCTACTCTCCCTGTGGCCACTGT
rJMFF025M03- TAAATCAACAGTGTCCCCAACCTTAACAGTGCCCCTCTCTACTCTCCCTGTGGCCACTGT
rJMFF016J01- TAAATCAACAGTGTCCCCAACCTTAACAGTGCCCCTCTCTACTCTCCCTGTGGCCACTGT
rJMFF022M19- TAAATCAACAGTGTCCCCAACCTTAACAGTGCCCCTCTCTACTCTCCCTGTGGCCACTGT
rJMSF022D19- TAAATCAACAGTGTCCCCAACCTTAACAGTGCCCCTCTCTACTCTCCCTGTGGCCACTGT
JMSF022D19+ TAAATCAACAGTGTCCCCAACCTTAACAGTGCCCCTCTCTACTCTCCCTGTGGCCACTGT
                      ____________________________________________________________
consensus TAAATCAACAGTGTCCCCAACCTTAACAGTGCCCCTCTCTACTCTCCCTGTGGCCACTGT
 
. : . : . : . : . : . :
rJMFF018F08- GCCTCTACCAGTAATGGAGAACACATCTTCAATGGCCATTA
rJMFF025M03- GCCTCTACCAGTAATGGAGAACACATCTTCAATGGCCATTAAAAATGGCAAATCAGTCTG
rJMFF016J01- GCCTCTACCAGTAATGGAGAACACATCTTCAATGGCCATTAAAAATGGCAAATCAGTCTG
rJMFF022M19- GCCTCTACCAGTAATGGAGAACACATCTTCAATGGCCATTAAAAATGGCAAATCAGTCTG
rJMSF022D19- GCCTCTACCAGTAATGGAGAACACATCTTCAATGGCCATTAAAAATGGCAAATCAGTCTG
JMSF022D19+ GCCTCTACCAGTAATGGAGAACACATCTTCAATGGCCATTAAAAATGGCAAATCAGTCTG
                      ____________________________________________________________
consensus GCCTCTACCAGTAATGGAGAACACATCTTCAATGGCCATTAAAAATGGCAAATCAGTCTG
 
. : . : . : . : . : . :
rJMFF025M03- TCTTTGT-GGGATAGGAATGTATGCATC
rJMFF016J01- TCTTTGTGGGGATAGGAATGTATGCATCCA
rJMFF022M19- TCTTTGT-GGGATAGGAATGTATGCATCCACAGAGTCCATTAGTTCATAAATCTTATCAA
rJMSF022D19- TCTTTGT-GGGATAGGAATGTATGCATCCACAGAGTCCATTAGTTCATAAATCTTATCAA
JMSF022D19+ TCTTTGT-GGGATAGGAATGTATGCATCCACAGAGTCCATTAGTTCATAAATCTTATCAA
                      ____________________________________________________________
consensus TCTTTGT-GGGATAGGAATGTATGCATCCACAGAGTCCATTAGTTCATAAATCTTATCAA
 
. : . : . : . : . : . :
rJMFF022M19- CCCATTGATTAT
rJMSF022D19- CCCATTGATTATCACCCCTTTTAAGACTAGGATTAGCCATTAAAGCCTCTAGAGCACACA
JMSF022D19+ CCCATTGATTATCACCCCTTTTAAGACTAGGATTAGCCATTAAAGCCTCTAGAGCACACA
                      ____________________________________________________________
consensus CCCATTGATTATCACCCCTTTTAAGACTAGGATTAGCCATTAAAGCCTCTAGAGCACACA
 
. : . : . : . : . : . :
rJMSF022D19- AAGCAGACCCGGAAACAATTGGAATATCATCACCAGGG
JMSF022D19+ AAGCAGACCCGGAAACAATTGGAATATCATCACCAGGGAATTCATAAGAGGATAACAGCT
                      ____________________________________________________________
consensus AAGCAGACCCGGAAACAATTGGAATATCATCACCAGGGAATTCATAAGAGGATAACAGCT
 
. : . : . : . : . : . :
JMSF022D19+ CTCTCACCTCCAATTCCACCAGCTGAAGAAGCTCCTCATCATCAACCTGGTCCTGTTTGT
                      ____________________________________________________________
consensus CTCTCACCTCCAATTCCACCAGCTGAAGAAGCTCCTCATCATCAACCTGGTCCTGTTTGT
 
. : . : . : . : . : . :
JMSF022D19+ TCAGAAACACCACCATATTAGGGACACCCACCTGCTTAGCCAACAAAATGTGTTCTTTGG
JMFS147C03+ CATATTAGGGACACCCACCTGCTTAGCCAACAAAATGTGTTCTTTGG
                      ____________________________________________________________
consensus TCAGAAACACCACCATATTAGGGACACCCACCTGCTTAGCCAACAAAATGTGTTCTTTGG
 
. : . : . : . : . : . :
JMSF022D19+ TCTGGGGCATCGGCCC
JMFS147C03+ TCTGGGGCATCGGCCCATCGGCGCCGGAAACCACCAGAATAGCCCCGTCCATCTGGGCAG
JMFF041L14+ GGGGCATCGGCCCATCGGCGCCGGAAACCACCAGAATAGCNCCGTCCATCTGGGCAG
JMFF016J01+ TGGGCAG
                      ____________________________________________________________
consensus TCTGGGGCATCGGCCCATCGGCGCCGGAAACCACCAGAATAGCCCCGTCCATCTGGGCAG
 
. : . : . : . : . : . :
JMFS147C03+ CTCCGGTAATCATATTCTTCACATAATCGGCATGGCCGGGGCAGTCGACGTGGGCGTAGT
JMFF041L14+ CTCCGGTAATCATATTCTTCACATAATCGGCATGGCCGGGGCAGTCGACGTGGGCGTAGT
JMFF018F08+ CTTCACATAATCGGCATGGCCGGGGCGGTCGACGTGGGCGTAGT
JMFF016J01+ CTCCGGTAATCATATTCTTCACATAATCGGCATGGCCGGGGCAGTCGACGTGGGCGTAGT
JMFF050M24+ CCGGTAATCATATTCTTCACATAATCGGCATGGCCGGGGCAGTCGACGTGGGCGTAGT
                      ____________________________________________________________
consensus CTCCGGTAATCATATTCTTCACATAATCGGCATGGCCGGGGCAGTCGACGTGGGCGTAGT
 
. : . : . : . : . : . :
JMFS147C03+ GCCGGTTCTCGGTCTCGTACTCCACCGTGGCGGTGTTAATGGTAATCCCACGGGCTCTCT
JMFF041L14+ GCCGGTTCTCGGTCTCGTACTCCACCGTGGCGGTGTTAATGGTAATCCCACGGGCTCTCT
JMFF018F08+ GCCGGTTCTCGGTCTCGTACTCCACCGT---GGTGTTAATGGTAATCCCACGGGCTCTCT
JMFF025M03+ CT
JMFF016J01+ GCCGGTTCTCGGTCTCGTACTCCACCGTGGCGGTGTTAATGGTAATCCCACGGGCTCTCT
JMFF050M24+ GCCGGTTCTCGGTCTCGTACTCCACCGTGGCGGTGTTAATGGTAATCCCACGGGCTCTCT
                      ____________________________________________________________
consensus GCCGGTTCTCGGTCTCGTACTCCACCGTGGCGGTGTTAATGGTAATCCCACGGGCTCTCT
 
. : . : . : . : . : . :
JMFS147C03+ CCTCCGGGGCGGCGTCGATTTCGTCGTATTTCTTGGGGGCGGAGTTGCCATTAGCGGCCA
JMFF041L14+ CCTCCGGGGCGGCGTCGATTTCGTCGTATTTCTTGGGGGCGGAGTTGCCATTAGCGGCCA
JMFF018F08+ CCTCCGGGGCGGCGTCGATTTCGTCGTATTTCTTGGGGGCGGAGTTGCCATTAGCGGCCA
JMFF025M03+ CCTCCGGGGCGGCGTCGATTTCGTCGTATTTCTTGGGGGCGGAGTTGCCATTAGCGGCCA
JMFF016J01+ CCTCCGGGGCGGCGTCGATTTCGTCGTATTTCTTGGGGGCGGAGTTGCCATTAGCGGCCA
JMFF050M24+ CCTCCGGGGCGGCGTCGATTTCGTCGTATTTCTTGGGGGCGGAGTTGCCATTAGCGGCCA
                      ____________________________________________________________
consensus CCTCCGGGGCGGCGTCGATTTCGTCGTATTTCTTGGGGGCGGAGTTGCCATTAGCGGCCA
 
. : . : . : . : . : . :
JMFS147C03+ AGGCCATGGTGAGGGCGGCGGTTAGGGTAGTCTTGCCGTGGTCGACGTGGCCGATTGTGC
JMFF041L14+ AGGCCATGGTGAGGGCGGCGGTTAGGGTAGTCTTGCCGTGGTCGACGTGGCCGATTGTGC
JMFF018F08+ AGGCCATGGTGAGGGCGGCGGTTAGGGTAGTCTTGCCGTGGTCGACGTGGCCGATTGTGC
JMFF025M03+ AGGCCATGGTGAGGGCGGCGGTTAGGGTAGTCTTGCCGTGGTCGACGTGGCCGATTGTGC
JMFF016J01+ AGGCCATGGTGAGGGCGGCGGTTAGGGTAGTCTTGCCGTGGTCGACGTGGCCGATTGTGC
JMFF050M24+ AGGCCATGGTGAGGGCGGCGGTTAGGGTAGTCTTGCCGTGGTCGACGTGGCCGATTGTGC
                      ____________________________________________________________
consensus AGGCCATGGTGAGGGCGGCGGTTAGGGTAGTCTTGCCGTGGTCGACGTGGCCGATTGTGC
 
. : . : . : . : . : . :
JMFS147C03+ CAATGTTGACGTGGGGCTTGTTCCTCTCGAACTTGCCGCGGGCGGCGCGAACCGTGAAGC
JMFF041L14+ CAATGTTGACGTGGGGCTTGTTCCTCTCGAACTTGCCGCGGGCGGCGCGAACCGTGAAGC
JMFF018F08+ CAATGTTGACGTGGGGCTTGTTCCTCTCGAACTTGCCGCGGGCGGCGCGAACCGTGAAGC
JMFF025M03+ CAATGTTGACGTGGGGCTTGTTCCTCTCGAACTTGCCGCGGGCGGCGCGAACCGTGAAGC
JMFF016J01+ CAATGTTGACGTGGGGCTTGTTCCTCTCGAACTTGCCGCGGGCGGCGCGAACCGTGAAGC
JMFF050M24+ CAATGTTGACGTGGGGCTTGTTCCTCTCGAACTTGCCGCGGGCGGCGCGAACCGTGAAGC
                      ____________________________________________________________
consensus CAATGTTGACGTGGGGCTTGTTCCTCTCGAACTTGCCGCGGGCGGCGCGAACCGTGAAGC
 
. : . : . : . : . : . :
JMFS147C03+ GCCGGTGGCGGATGGCCGCGGAGGGAACGGAGGCGGAGGGGGAGTGGACGAAGTGGGTGG
JMFF041L14+ GCCGGTGGCGGATGGCCGCGGAGGGAACGGAGGCGGAGGGGGAGTGGACGAAGTGGGTGG
JMFF018F08+ GCCGGTGGCGGATGGCCGCGGAGGGAACGGAGGCGGAGGGGGAGTGGACGAAGTGGGTGG
JMFF025M03+ GCCGGTGGCGGATGGCCGCGGAGGGAACGGAGGCGGAGGGGGAGTGGACGAAGTGGGTGG
JMFF016J01+ GCCGGTGGCGGATGGCCGCGGAGGGAACGGAGGCGGAGGGGGAGTGGACGAAGTGGGTGG
JMFF050M24+ GCCGGTGGCGGATGGCCGCGGAGGGAACGGAGGCGGAGGGGGAGTGGACGAAGTGGGTGG
                      ____________________________________________________________
consensus GCCGGTGGCGGATGGCCGCGGAGGGAACGGAGGCGGAGGGGGAGTGGACGAAGTGGGTGG
 
. : . : . : . : . : . :
JMFS147C03+ ATAGAGTTGGGGTGAAAGAAGAGGATAAGATAAGCTTAGAGGGTTTTGCGGAGGTGGGGG
JMFF041L14+ ATAGAGTTGGGGTGAAAGAAGAGGATAAGATAAGCTTAGAGGGTTTTGCGGAGGTGGGGG
JMFF018F08+ ATAGAGTTGGGGTGAAAGAAGAGGATAAGATAAGCTTAGAGGGTTTTGCGGAGGTGGGGG
JMFF025M03+ ATAGAGTTGGGGTGAAAGAAGAGGATAAGATAAGCTTAGAGGGTTTTGCGGAGGTGGGGG
JMFF016J01+ ATAGAGTTGGGGTGAAAGAAGAGGATAAGATAAGCTTAGAGGGTTTTGCGGAGGTGGGGG
JMFF050M24+ ATAGAGTTGGGGTGAAAGAAGAGGATAAGATAAGCTTAGAGGGTTTTGCGGAGGTGGGGG
                      ____________________________________________________________
consensus ATAGAGTTGGGGTGAAAGAAGAGGATAAGATAAGCTTAGAGGGTTTTGCGGAGGTGGGGG
 
. : . : . : . : . : . :
JMFS147C03+ TGGAAGAAGGGGTGTATGGGTATACTAATTTGGCGTTGACGGCGGCCGCGGCGGCAGAAA
JMFF041L14+ TGGAAGAAGGGGTGTATGGGTATACTAATTTGGCGTTGACGGCGGCCGCGGCGGCAGAAA
JMFF018F08+ TGGAAGAAGGGGTGTATGGGTATACTAATTTGGCGTTGACGGCGGCCGCGGCGGCAGAAA
JMFF025M03+ TGGAAGAAGGGGTGTATGGGTATACTAATTTGGCGTTGACGGCGGCCGCGGCGGCAGAAA
JMFF016J01+ TGGAAGAAGGGGTGTATGGGTATACTAATTTGGCGTTGACGGCGGCCGCGGCGGCAGAAA
JMFF050M24+ TGGAAGAAGGGGTGTATGGGTATACTAATTTGGCGTTGACGGCGGCCGCGGCGGCAGAAA
                      ____________________________________________________________
consensus TGGAAGAAGGGGTGTATGGGTATACTAATTTGGCGTTGACGGCGGCCGCGGCGGCAGAAA
 
. : . : . : . : . : . :
JMFS147C03+ TGGAAGCCATTGTGGCTGAAATTTGAGAGAGAA
JMFF041L14+ TGGAAGCCATTGTGGCTGAAATTTGAGAGAGAACCGGAGGAAGAAGAAGAGGATAGGGTG
JMFF018F08+ TGGAAGCCATTGTGGCTGAAATTTGAGAGAGAACCGGAGGAAGAAGAAGAGGATAGGGTG
JMFF025M03+ TGGAAGCCATTGTGGCTGAAATTTGAGAGAGAACCGGAGGAAGAAGAAGAGGATAGGGTG
JMFF016J01+ TGGAAGCCATTGTGGCTGAAATTTGAGAGAGAACCGGAGGAAGAAGAAGAGGATAGGGTG
JMFF050M24+ TGGAAGCCATTGTGGCTGAAATTTGAGAGAGAACCGGAGGAAGAAGAAGAGGATAGGGTG
                      ____________________________________________________________
consensus TGGAAGCCATTGTGGCTGAAATTTGAGAGAGAACCGGAGGAAGAAGAAGAGGATAGGGTG
 
. : . : . : . : . : . :
JMFF041L14+ GAGATGAGAGAGGAGTTAAGAGAGTTTTGGGTGAGAAATCGGAAATGTGGCTGAAA
JMFF018F08+ GAGATGAGAGAGGAGTTAAGAGAGTTTTGGGTGAGAAATCGGAAATGTGGCTGAAAC
JMFF025M03+ GAGATGAGAGAGGAGTTAAGAGAGTTTTGGGTGAGAAATCGGAAATGTGGCTGAAAC
JMFF016J01+ GAGATGAGAGAGGAGTTAAGAGAGTTTTGGGTGAGAAATCGGAAATGTGGCTGAAAC
JMFF050M24+ GAGATGAGAGAGGAGTTAAGAGAGTTTTGGGTGAGAAATCGGAAATGTGGCTGAAACCGG
                      ____________________________________________________________
consensus GAGATGAGAGAGGAGTTAAGAGAGTTTTGGGTGAGAAATCGGAAATGTGGCTGAAACCGG