Previous Contig 002168:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013A18Sequence615002168 (7)gb:AY263347_15937586e-56Glycine max protein kinase Pti1 (Pti1) mRNA, complete cds.745011019 (7)gb:AY263347_15937584e-53Glycine max protein kinase Pti1 (Pti1) mRNA, complete cds.
JMFF013N04Sequence547002168 (7)643011019 (7)gb:AY263347_15937582e-25Glycine max protein kinase Pti1 (Pti1) mRNA, complete cds.
JMFF014H05Sequence604002168 (7)gb:AY263347_15937589e-65Glycine max protein kinase Pti1 (Pti1) mRNA, complete cds.797011019 (7)gb:AY263347_15937582e-59Glycine max protein kinase Pti1 (Pti1) mRNA, complete cds.
JMFF045G07Sequence626002168 (7)gb:AY263347_15937582e-73Glycine max protein kinase Pti1 (Pti1) mRNA, complete cds.579011019 (7)gb:AY263347_15937588e-15Glycine max protein kinase Pti1 (Pti1) mRNA, complete cds.
JMFF050L22Sequence629002168 (7)gb:AY263347_15937584e-07Glycine max protein kinase Pti1 (Pti1) mRNA, complete cds.537011019 (7)gb:AY263347_15937582e-05Glycine max protein kinase Pti1 (Pti1) mRNA, complete cds.
JMFS077C04Sequence626002168 (7)gb:AY263347_15937586e-67Glycine max protein kinase Pti1 (Pti1) mRNA, complete cds.
JMSF014E07Sequence306002168 (7)gb:AY263347_15937582e-19Glycine max protein kinase Pti1 (Pti1) mRNA, complete cds.742011019 (7)gb:AY263347_15937581e-55Glycine max protein kinase Pti1 (Pti1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF014H05+ CATGTAGTATATCATGTAGAGAC
JMFS077C04+ CTTCCTTCCATGTAGTATATCATGTAGAGAC
JMFF045G07+ GGCCAGGCTGTGCCCCTTGTACTCCCTTCCTTCCATGTAGTATATCATGTAGAGAC
                      ____________________________________________________________
consensus GGCCAGGCTGTGCCCCTTGTACTCCCTTCCTTCCATGTAGTATATCATGTAGAGAC
 
. : . : . : . : . : . :
JMFF014H05+ CCCATGGTNGCAAACTCATAAGCTAATATACGGAGATTGCCTTCCACGCAGTAACCAAGC
JMFS077C04+ CCCATGGTTGCAAACTCATAAGCTAATATACGGAGATTGCCTTCCACGCAGTAACCAAGC
JMFF013A18+ CGGAGATTGCCTTCCACGCAGTAACCAAGC
JMFF045G07+ CCCATGGTTGCAAACTCATAAGCTAATATACGGAGATTGCCTTCCACGCAGTAACCAAGC
                      ____________________________________________________________
consensus CCCATGGTTGCAAACTCATAAGCTAATATACGGAGATTGCCTTCCACGCAGTAACCAAGC
 
. : . : . : . : . : . :
JMFF014H05+ AATTCAACGAGATTTTCATGCTTCAACTTGGAAACCATAGAAACCTGAGTCAGGAACTCA
JMFS077C04+ AATTCAACGAGATTTTCATGCTTCAACTTGGAAACCATAGAAACCTGAGTCAGGAACTCA
JMFF013A18+ AATTCAACGAGATTTTCATGCTTCAACTTGGAAACCATAGAAACCTGAGTCAGGAACTCA
JMFF045G07+ AATTCAACGAGATTTTCATGCTTCAACTTGGAAACCATAGAAACCTGAGTCAGGAACTCA
                      ____________________________________________________________
consensus AATTCAACGAGATTTTCATGCTTCAACTTGGAAACCATAGAAACCTGAGTCAGGAACTCA
 
. : . : . : . : . : . :
JMFF014H05+ GCATTTGAATCTTACTCAGATGAAACATCTAGCTTTTTCACAGCTACAGATTTACCATCA
JMFS077C04+ GCATTTGAATCTTGCTCAGATGAAACATCTAGCTTTTTCACAGCTACAGATTTACCATCA
JMFF013A18+ GCATTTGAATCTTGCTCAGATGAAACATCTAGCTTTTTCACAGCTACAGATTTACCATCA
JMFF045G07+ GCATTTGAATCTTGCTCAGATGAAACATCTAGCTTTTTCACAGCTACAGATTTACCATCA
                      ____________________________________________________________
consensus GCATTTGAATCTTGCTCAGATGAAACATCTAGCTTTTTCACAGCTACAGATTTACCATCA
 
. : . : . : . : . : . :
JMFF014H05+ TTTAGATTCGCAAAGTACACTCTTCCATAAGATCCTTCACCAATTAAAGCCTTTGACCCA
JMFS077C04+ TTTAGATTCGCAAAGTACACTCTTCCATAAGATCCTTCACCAATTAAAGCCTTTGACCCA
JMFF013A18+ TTTAGATTCGCAAAGTACACTCTTCCATAAGATCCTTCACCAATTAAAGCCTTTGACCCA
JMFF045G07+ TTTAGATTCGCAAAGTACACTCTTCCATAAGATCCTTCACCAATTAAAGCCTTTGACCCA
                      ____________________________________________________________
consensus TTTAGATTCGCAAAGTACACTCTTCCATAAGATCCTTCACCAATTAAAGCCTTTGACCCA
 
. : . : . : . : . : . :
JMFF014H05+ AAATTTTCAGTTTGCTCTTTCAGTTCATCCAGAGACAACTCTGGCACCTCGATTGATGGT
JMFS077C04+ AAATTTTCAGTTTGCTCTTTCAGTTCATCCAGAGACAACTCTGGCACCTCGATTGATGGT
JMFF013A18+ AAATTTTCAGTTTGCTCTTTCAGTTCATCCAGAGACAACTCTGGCACCTCGATTGATGGT
JMSF014E07+ TTCATCCAGAGACAACTCNGGCACCTCGATTGATGGT
JMFF045G07+ AAATTTTCAGTTTGCTCTTTCAGTTCATCCAGAGACAACTCTGGCACCTCGATTGATGGT
                      ____________________________________________________________
consensus AAATTTTCAGTTTGCTCTTTCAGTTCATCCAGAGACAACTCTGGCACCTCGATTGATGGT
 
. : . : . : . : . : . :
JMFF014H05+ ATTGCTTTTTGCACTTCAGTCTTGACAGGAGTTGCTACCTTCGTGCCTTTTTCATACCTG
JMFS077C04+ ATTGCTTTTTGCACTTCAGTCTTGACAGGAGTTGCTACCTTCGTGCCTTTTTCATACCTG
JMFF013A18+ ATTGCTTTTTGCACTTCAGTCTTGACAGGAGTTGCTACCTTCGTGCCTTTTTCATAC---
JMSF014E07+ ATTGCTTTTTGCACTTCAGTCTTGACAGGAGTTGCTACCTTCGTGCCTTTTTCATAC---
JMFF045G07+ ATTGCTTTTTGCACTTCAGTCTTGACAGGAGTTGCTACCTTCGTGCCTTTTTCATAC---
JMFF050L22+ TTCAGTCTTGACAGGAGTTGCTACCTTCGTGCC-TTTTCATAC---
                      ____________________________________________________________
consensus ATTGCTTTTTGCACTTCAGTCTTGACAGGAGTTGCTACCTTCGTGCCTTTTTCATAC---
 
. : . : . : . : . : . :
JMFF014H05+ CCAAATTTACCATCAGCATCATTTGTGGGGCCTTTTAGTGCCTCACTTTCATGAGATGGG
JMFS077C04+ CCAAATTTACCATCAGCATCATTTGTGGGGCCTTTTAGTGCCTCACTTTCATGAGATGGG
JMFF013A18+ ---------CCATCAGCATCATTTGTGGGGCCTTTTAGTGCCTCACTTTCATGAGATGGG
JMSF014E07+ ---------CCATCAGCATCATTTGTGGGGCCTTTTAGTGCCTCACTTTCATGAGATGGG
JMFF045G07+ ---------CCATCAGCATCATTTGTGGGGCCTTTTAGTGCCTCACTTTCATGAGATGGG
JMFF013N04+ TCATGAGATGGG
JMFF050L22+ ---------CCATCAGCATCATTTGTGGGGCCTTTTAGTGCCTCACTTTCATGAGATGGG
                      ____________________________________________________________
consensus ---------CCATCAGCATCATTTGTGGGGCCTTTTAGTGCCTCACTTTCATGAGATGGG
 
. : . : . : . : . : . :
JMFF014H05+ TAGGATTCCTCTACTTGGCAGGTGCAACACAGCCACTTCCGCATCCTTGATTTCTCACTT
JMFS077C04+ TAGGATTCCTCTACTTGGCAGGTGCAACACAGCCACTTCCGCATCCTTGATTTCTCACTT
JMFF013A18+ TAGGATTCCTCTACTTGGCAGGTGCAACACAGCCACTTCCGCATCCTTGATTTCTCACTT
JMSF014E07+ TAGGATTCCTCTACTTGGCAGGTGCAACACAGCCACTTCCGCATCCTTGATTTCTCACTT
JMFF045G07+ TAGGATTCCTCTACTTGGCAGGTGCAACACAGCCACTTCCGCATCCTTGATTTCTCACTT
JMFF013N04+ TAGGATTCCTCTACTTGGCAGGTGCAACACAGCCGCTTCCGCATCCTTGATTTCTCACTT
JMFF050L22+ TAGGATTCCTCTACTTGGCAGGTGCAACACAGCCGCTTCCGCATCCTTGATTTCTCACTT
                      ____________________________________________________________
consensus TAGGATTCCTCTACTTGGCAGGTGCAACACAGCCACTTCCGCATCCTTGATTTCTCACTT
 
. : . : . : . : . : . :
JMFF014H05+ AATTAAAATATTAACTTGTGTTCCCCAATTGTAAAAAGCAACCAGGAGGAGACGCATGTG
JMFS077C04+ AATTAAAATATTAACTTGTGTTCCCCAATTGTAAAAAGCAACCAGGAGGAGACGCATGTG
JMFF013A18+ AATTAAAATATTAACTTGTGTTCCCCAATTGTAAAAAGCAACCAGGAGGAGACGCATGTG
JMSF014E07+ AATTAAAATATTAACTTGTGTTCCCCAATTGTAAAAAGCAACCAGGAGGAGACGCATGTG
JMFF045G07+ AATTAAAATATTAACTTGTGTTCCCCAATTGTAAAAAGCAACCAGGAGGAGACGCATGTG
JMFF013N04+ AATTAAAATATTAACTTGTGTTCCCCAATTGTAAAAAGCAACCAGGAGGAGACGCATGTG
JMFF050L22+ AATTAAAATATTAACTTGTGTTCCCCAATTGTAAAAAGCAACCAGGAGGAGACGCATGTG
                      ____________________________________________________________
consensus AATTAAAATATTAACTTGTGTTCCCCAATTGTAAAAAGCAACCAGGAGGAGACGCATGTG
 
. : . : . : . : . : . :
JMFF014H05+ CCTGGAAGATCTGAAAGATGGTAGTTT-CCGGTGGAAT
JMFS077C04+ CC
JMFF013A18+ CC
JMSF014E07+ CCTGGAAGATCTGAAAGATGGTAGTTT-CCGGTGGAATCTT
JMFF045G07+ CCTGGAAGATCTGAAAGATGGTAGTTTCCNGGTGGAATCTT
JMFF013N04+ CC--CAAG-TCAGACA-AAGTTCCACTGCCCCTGCATTCATTGTCTTGTGAATGTTTCAG
JMFF050L22+ CC--CAAG-TCAGACA-AAGTTCCACTGCCCCTGCATTCATTGTCTTGTGAATGTTTCAG
                      ____________________________________________________________
consensus CCTGGAAGATCTGAAAGATGGTAGTTTGCCGGTGGAATCTTTGTCTTGTGAATGTTTCAG
 
. : . : . : . : . : . :
JMFF013N04+ ATTCGCATTGTAACATCTGAAAACAGTAGTCAAGCAAATTGCGAGTACACGTATGAATCT
JMFF050L22+ ATTCGCATTGTAACATCTGAAAACAGTAGTCAAGCAAATTGCGAGTACACGTATGAATCT
                      ____________________________________________________________
consensus ATTCGCATTGTAACATCTGAAAACAGTAGTCAAGCAAATTGCGAGTACACGTATGAATCT
 
. : . : . : . : . : . :
JMFF013N04+ ATCAGGATTATTAATGCAATTCCTTATATTAACCAGTTCCAAGTTTAAACTCCCTACAAA
JMFF050L22+ ATCAGGATTATTAATGCAATTCCTTATATTAACCAGTTCCAAGTTTAAACTCCCTACAAA
                      ____________________________________________________________
consensus ATCAGGATTATTAATGCAATTCCTTATATTAACCAGTTCCAAGTTTAAACTCCCTACAAA
 
. : . : . : . : . : . :
JMFF013N04+ GCAAGTAAAATCTACATGCTGAAGATTGAAGAAATTAAAGACCGGATAGATCTCTTCATC
JMFF050L22+ GCAAGTAAAATCTACATGCTGAAGATTGAAGAAATTAAAGACCGGATAGATCTCTTCATC
                      ____________________________________________________________
consensus GCAAGTAAAATCTACATGCTGAAGATTGAAGAAATTAAAGACCGGATAGATCTCTTCATC
 
. : . : . : . : . : . :
JMFF013N04+ ATTCAACTAAAATCTCAACGAAAATCGAGCACCAGAACAACCTAACGAGCTCAGCGAAAT
JMFF050L22+ ATTCAACTAAAATCTCAACGAAAATCGAGCACCAGAACAACCTAACGAGCTCAGCGAAAT
                      ____________________________________________________________
consensus ATTCAACTAAAATCTCAACGAAAATCGAGCACCAGAACAACCTAACGAGCTCAGCGAAAT
 
. : . : . : . : . : . :
JMFF013N04+ ATCATCTAACCCAAATTTGATCAATACAAATCAACACGAGCTATGAATTTCACTTTCGTA
JMFF050L22+ ATCATCTAACCCAAATTTGATCAATACAAATCAACACGAGCTATGAATTTCACTTTCGTA
                      ____________________________________________________________
consensus ATCATCTAACCCAAATTTGATCAATACAAATCAACACGAGCTATGAATTTCACTTTCGTA
 
. : . : . : . : . : . :
JMFF013N04+ AGAAAACATTATAGCACAAATTGGCGAAAGAAAACACGGAATTGGATTGAAATAAGAAC
JMFF050L22+ AGAAAACATTATAGCACAAATTGGCGAAAGAAAACACGGAATTGGATTGAAATAAGAACC
                      ____________________________________________________________
consensus AGAAAACATTATAGCACAAATTGGCGAAAGAAAACACGGAATTGGATTGAAATAAGAACC