Previous Contig 002167:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003K24Sequence338002167 (4)631010783 (3)pir|F86156|F861565e-19hypothetical protein T14P4.6 - Arabidopsis thaliana>gb:AE005172_889287 Arabidops
JMFF034I08Sequence516002167 (4)gb:AY054280_15631000.026Arabidopsis thaliana AT3g62590/F26K9_20 mRNA, complete cds.>gb:BT002305_1635908 716010783 (3)pir|F86156|F861563e-28hypothetical protein T14P4.6 - Arabidopsis thaliana>gb:AE005172_889287 Arabidops
JMFF047P04Sequence570002167 (4)gb:AY054280_15631005e-04Arabidopsis thaliana AT3g62590/F26K9_20 mRNA, complete cds.>gb:BT002305_1635908 566010783 (3)pir|F86156|F861567e-05hypothetical protein T14P4.6 - Arabidopsis thaliana>gb:AE005172_889287 Arabidops
JMFF050L08Sequence623002167 (4)gb:AY054280_15631006e-04Arabidopsis thaliana AT3g62590/F26K9_20 mRNA, complete cds.>gb:BT002305_1635908

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF047P04+ CGGCACATACATCGGACTCTTCAC
JMFF050L08+ GGCACATACATCGGACTCTTCAC
                      ____________________________________________________________
consensus CGGCACATACATCGGACTCTTCAC
 
. : . : . : . : . : . :
JMFF047P04+ CGGCATCACTAATTCGGCCTTCAATTTTCGCAGCCTCGGAGTTCCCAAGTCCACAGCTTT
JMFF034I08+ CAGCCTCGGAGTTCCCAAGTCCACAGCTTT
JMFF050L08+ CGGCATCACTAATTCGGCCTTCAATTTTCGCAGCCTCGGAGTTCCCAAGTCCACAGCTTT
                      ____________________________________________________________
consensus CGGCATCACTAATTCGGCCTTCAATTTTCGCAGCCTCGGAGTTCCCAAGTCCACAGCTTT
 
. : . : . : . : . : . :
JMFF047P04+ TATGGCCTCCATTGCGCAGAGATCGCACGCGGAGTATCTTCATAACCCAACTATCTTTCT
JMFF034I08+ TATGGCCTCCATTGCGCAGAGATCGCACGCGGAGTATCTTCATAACCCAACTATCTTTCT
JMFF050L08+ TATGGCCTCCATTGCGCAGAGATCGCACGCGGAGTATCTTCATAACCCAACTATCTTTCT
                      ____________________________________________________________
consensus TATGGCCTCCATTGCGCAGAGATCGCACGCGGAGTATCTTCATAACCCAACTATCTTTCT
 
. : . : . : . : . : . :
JMFF047P04+ GTTCCGCCGCCCTCCGTTTCACGTTTTCGTCGATCAAAACGACGTCGTCGCCGGCCATGA
JMFF034I08+ GTTCCGCCGCCCTCCGTTTCACGTTTTCGTCGATCAAAACGACGTCGTCGCCGGCCATGA
JMFF050L08+ GTTCCGCCGCCCTCCGTTTCACGTTTTCGTCGATCAAAACGACGTCGTCGCCGGCCATGA
                      ____________________________________________________________
consensus GTTCCGCCGCCCTCCGTTTCACGTTTTCGTCGATCAAAACGACGTCGTCGCCGGCCATGA
 
. : . : . : . : . : . :
JMFF047P04+ CAACGCACCGCCTTCTACCACCGGGCCACCGATATGTACGGAAAGACAACCGCCGAGGGG
JMFF034I08+ CAACGCACCGCCTTCTACCACCGGGCCACCGATATGTACGGAAAGACAACCGCCGAGGGG
JMFF003K24+ CCGATATGTACGGAAAGACANCCGCCGAGGGG
JMFF050L08+ CAACGCACCGCCTTCTACCACCGGGCCACCGATATGTACGGAAAGACAACCGCCGAGGGG
                      ____________________________________________________________
consensus CAACGCACCGCCTTCTACCACCGGGCCACCGATATGTACGGAAAGACAACCGCCGAGGGG
 
. : . : . : . : . : . :
JMFF047P04+ AAATCCTCTGCGGGATCGACAGTGACGGCTTCTCCACTGAAACCACCGCACAAGACCGCC
JMFF034I08+ AAATCCTCTGCGGGATCGACAGTGACGGCTTCTCCACTGAAACCACCGCACAAGACCGCC
JMFF003K24+ AAATCCTCTGCGGGATCGACAGTGACGGCTTCTCCACTGAAACCACCGCACAAGACCGCC
JMFF050L08+ AAATCCTCTGCGGGATCGACAGTGACGGCTTCTCCACTGAAACCACCGCACAAGACCGCC
                      ____________________________________________________________
consensus AAATCCTCTGCGGGATCGACAGTGACGGCTTCTCCACTGAAACCACCGCACAAGACCGCC
 
. : . : . : . : . : . :
JMFF047P04+ CAACGGATGAAGCATTAACGTGCGAGGGAAGGGTGGCACGGACATCCAACGCAGCGCCGC
JMFF034I08+ CAACGGATGAAGCATTAACGTGCGAGGGAAGGGTGGCACGGACATCCAACGCAGCGCCGC
JMFF003K24+ CAACGGATGAAGCATTAACGTGCGAGGGAAGGGTGGCACGGACATCCAACGCAGCGCCGC
JMFF050L08+ CAACGGATGAAGCATTAACGTGCGAGGGAAGGGTGGCACGGACATCCAACGCAGCGCCGC
                      ____________________________________________________________
consensus CAACGGATGAAGCATTAACGTGCGAGGGAAGGGTGGCACGGACATCCAACGCAGCGCCGC
 
. : . : . : . : . : . :
JMFF047P04+ CGCCGCCGCCGCCCACCCCTGCCTTCAAACAAAGAGTGTCCATCTGGTTGGCGTTGGAGG
JMFF034I08+ CGCCGCCGCCGCCCACCCCTGCCTTCAAACAAAGAGTGTCCATCTGGTTGGCGTTGGAGG
JMFF003K24+ CGCCGCCGCCGCCCACCCCTGCCTTCAAACAAAGAGTGTCCATCTGGTTGGCGTTGGAGG
JMFF050L08+ CGCCGCCGCCGCCCACCCCTGCCTTCAAACAAAGAGTGTCCATCTGGTTGGCGTTGGAGG
                      ____________________________________________________________
consensus CGCCGCCGCCGCCCACCCCTGCCTTCAAACAAAGAGTGTCCATCTGGTTGGCGTTGGAGG
 
. : . : . : . : . : . :
JMFF047P04+ GTGGTGGGGACCCAGACCGAGCCCGGCCAGAGTGGGCTGTGTACTTGTGTAGAACGCGGA
JMFF034I08+ GTGGTGGGGACCCAGACCGAGCCCGGCCAGAGTGGGCTGTGTACTTGTGTAGAACGCGGA
JMFF003K24+ GTGGTGGGGACCCAGACCGAGCCCGGCCAGAGTGGGCTGTGTACTTGTGTAGAACGCGGA
JMFF050L08+ GTGGTGGGGACCCAGACCGAGCCCGGCCAGAGTGGGCTGTGTACTTGTGTAGAACGCGGA
                      ____________________________________________________________
consensus GTGGTGGGGACCCAGACCGAGCCCGGCCAGAGTGGGCTGTGTACTTGTGTAGAACGCGGA
 
. : . : . : . : . : . :
JMFF047P04+ GCTCTTAGGTTGTACACCAATGTTTGAATTCCTTAGTACTATCGATTGACTTTGTAGAAG
JMFF034I08+ GCTCTTAGGTTGTACACCAATGTTTGAATTCCTTAGTACTATCGATTGACTTTGTAGAAG
JMFF003K24+ GCTCTTAGGTTGTACACCAATGTTTGAATTCCTTAGTACTATCGATTGACTTTGTAGAAG
JMFF050L08+ GCTCTTAGGTTGTACACCAATGTTTGAATTCCTTAGTACTATCGATTGACTTTGTAGAAG
                      ____________________________________________________________
consensus GCTCTTAGGTTGTACACCAATGTTTGAATTCCTTAGTACTATCGATTGACTTTGTAGAAG
 
. : . : . : . : . : . :
JMFF047P04+ GATCA
JMFF034I08+ GATCA
JMFF003K24+ GATCA
JMFF050L08+ GATCACAAGAGAGGATGAAAGAAAGAACGAAAGCTTCTGTTATAACGACACACAAACACC
                      ____________________________________________________________
consensus GATCACAAGAGAGGATGAAAGAAAGAACGAAAGCTTCTGTTATAACGACACACAAACACC