Previous Contig 002165:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005E07Sequence311002165 (8)gb:AY099879_15769043e-18Arabidopsis thaliana unknown protein (At4g36630) mRNA, complete cds.724011012 (2)gb:AY099879_15769043e-87Arabidopsis thaliana unknown protein (At4g36630) mRNA, complete cds.
JMFF010J09Sequence549002165 (8)gb:AY099879_15769041e-63Arabidopsis thaliana unknown protein (At4g36630) mRNA, complete cds.722003387 (3)gb:AY099879_15769042e-54Arabidopsis thaliana unknown protein (At4g36630) mRNA, complete cds.
JMFF050K12Sequence582002165 (8)gb:AY099879_15769045e-52Arabidopsis thaliana unknown protein (At4g36630) mRNA, complete cds.616011012 (2)pir|E85432|E854323e-54hypothetical protein AT4g36630 [imported] - Arabidopsis thaliana>gb:ATAP22_15440
JMFS091F05Sequence621002165 (8)gb:AY099879_15769041e-76Arabidopsis thaliana unknown protein (At4g36630) mRNA, complete cds.
JMFS096C08Sequence605002165 (8)gb:AY099879_15769042e-72Arabidopsis thaliana unknown protein (At4g36630) mRNA, complete cds.
JMFS134A04Sequence621002165 (8)gb:AY099879_15769045e-75Arabidopsis thaliana unknown protein (At4g36630) mRNA, complete cds.
JMSF023C06Sequence664002165 (8)gb:AY099879_15769043e-81Arabidopsis thaliana unknown protein (At4g36630) mRNA, complete cds.711003387 (3)gb:AY099879_15769041e-53Arabidopsis thaliana unknown protein (At4g36630) mRNA, complete cds.
JMSF033J15Sequence677002165 (8)gb:AY099879_15769045e-81Arabidopsis thaliana unknown protein (At4g36630) mRNA, complete cds.214003309 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023C06+ CCCCAAAAGAAGTTCTCCAGATGGAAGTGACACCACAAGAGGGGGGGCAGTCCTCCCT
JMFS134A04+ GGGGGGGCAGTCCTCCCT
JMFS091F05+ AGTTCTCCAGATGGAAGTGACACCACAAGAGGGGGGGCAGTCCTCCCT
JMFS096C08+ T
JMSF033J15+ CCCAAAAGAAGTTCTCCAGATGGAAGTGACACCACAAGAGGGGGGGCAGTCCTCCCT
                      ____________________________________________________________
consensus CCCCAAAAGAAGTTCTCCAGATGGAAGTGACACCACAAGAGGGGGGGCAGTCCTCCCT
 
. : . : . : . : . : . :
JMSF023C06+ GAAGGAAACACNTCAGACATTGCTCCATTTGTGGTATTCAATATCATGTAATCTCTTCTA
JMFS134A04+ GAAGGAAACACCTCAGACATTGCTCCATTTGTGGTATTCAATATCATGTAATCTCTTCTA
JMFS091F05+ GAAGGAAACACCTCAGACATTGCTCCATTTGTGGTATTCAATATCATGTAATCTCTTCTA
JMFS096C08+ GAAGGAAACACCTCAGACATTGCTCCATTTGTGGTATTCAATATCATGTAATCTCTTCTA
JMSF033J15+ GAAGGAAACACNTCAGACATTGCTCCATTTGTGGTATTCAATATCATGTAATCTCTTCTA
                      ____________________________________________________________
consensus GAAGGAAACACCTCAGACATTGCTCCATTTGTGGTATTCAATATCATGTAATCTCTTCTA
 
. : . : . : . : . : . :
JMSF023C06+ ATTCCCAAGCAAATATTATCGCCGCACCAAGCCATTGACTTAACCGTATCTGGTACTCCA
JMFS134A04+ ATTCCCAAGCAAATATTATCGCCGCACCAAGCCATTGACTTAACCGTATCTGGTACTCCA
JMFS091F05+ ATTCCCAAGCAAATATTATCGCCGCACCAAGCCATTGACTTAACCGTATCTGGTACTCCA
JMFS096C08+ ATTCCCAAGCAAATATTATCGCCGCACCAAGCCATTGACTTAACCGTATCTGGTACTCCA
JMFF010J09+ TTCCCAAGCAAATATTATCGCCGCACCAAGACATTGACTTAACCGTATCTGGTACTCCA
JMSF033J15+ ATTCCCAAGCAAATATTATCGCCGCACCAAGCCATTGACTTAACCGTATCTGGTACTCCA
JMFF050K12+ TCGCCGCACCAAGCCATTGACTTAACCGTATCTGGTACTCCA
                      ____________________________________________________________
consensus ATTCCCAAGCAAATATTATCGCCGCACCAAGCCATTGACTTAACCGTATCTGGTACTCCA
 
. : . : . : . : . : . :
JMSF023C06+ AATTCTTTAACCTCTACGAAACCCCTTCCTCCGTCATGTCTGAAAATACAAACTCTTTTT
JMFS134A04+ AATTCTTTAACCTCTACGAAACCCCTTCCTCCGTCATGTCTGAAAATACAAACTCTTTTT
JMFS091F05+ AATTCTTTAACCTCTACGAAACCCCTTCCTCCGTCATGTCTGAAAATACAAACTCTTTTT
JMFS096C08+ AATTCTTTAACCTCTACGAAACCCCTTCCTCCGTCATGTCTGAAAATACAAACTCTTTTT
JMFF010J09+ AATTCTTTAACCTCTACGAAACCCCTTCCTCCGTCATGTCTGAAAATACAAACTCTTTTT
JMSF033J15+ AATTCTTTAACCTCTACGAAACCCCTTCCTCCGTCATGTCTGAAAATACAAACTCTTTTT
JMFF050K12+ AATTCTTNAACCTCTACGAAACCCCTTCCTCCGTCATGTCTGAAAATACAAACTCTTTTT
                      ____________________________________________________________
consensus AATTCTTTAACCTCTACGAAACCCCTTCCTCCGTCATGTCTGAAAATACAAACTCTTTTT
 
. : . : . : . : . : . :
JMSF023C06+ TGTCTCGCGAAGCAAAGATACCCTCTCCTATCGTCCCACGAGTACACATTCGCCCCTTTT
JMFS134A04+ TGTCTCGCGAAGCAAAGATACCCTCTCCTATCGTCCCACGAGTACACATTCGCCCCTTTT
JMFS091F05+ TGTCTCGCGAAGCAAAGATACCCTCTCCTATCGTCCCACGAGTACACATTCGCCCCTTTT
JMFS096C08+ TGTCTCGCGAAGCAAAGATACCCTCTCCTATCGTCCCACGAGTACACATTCGCCCCTTTT
JMFF010J09+ TGTCTCGCGAAGCAAAGATACCCTCTCCTATCGTCCCACGAGTACACATTCGCCCCTTTT
JMSF033J15+ TGTCTCGCGAAGCAAAGATACCCTCTCCTATCGTCCCACGAGTACACATTCGCCCCTTTT
JMFF050K12+ TGTCTCGCGAAGCAAAGATACCCTCTCCTATCGTCCCACGAGTACACATTCGCCCCTTTT
                      ____________________________________________________________
consensus TGTCTCGCGAAGCAAAGATACCCTCTCCTATCGTCCCACGAGTACACATTCGCCCCTTTT
 
. : . : . : . : . : . :
JMSF023C06+ GCCTTCGTAATCACGGCCAGGGTCTCCAAATTGGGCAACCGATGGAACGCGATGGACTCG
JMFS134A04+ GCCTTCGTAATCACGGCCAGGGTCTCCAAATTGGGCAACCGATGGAACGCGATGGACTCG
JMFS091F05+ GCCTTCGTAATCACGGCCAGGGTCTCCAAATTGGGCAACCGATGGAACGCGATGGACTCG
JMFS096C08+ GCCTTCGTAATCACGGCCAGGGTCTCCAAATTGGGCAACCGATGGAACGCGATGGACTCG
JMFF010J09+ GCCTTCGTAATCACGGCCAGGGTCTCCAAATTGGGCAACCGATGGAACGCGATGGACTCG
JMSF033J15+ GCCTTCGTAATCACGGCCAGGGTCTCCAAATTGGGCAACCGATGGAACGCGATGGACTCG
JMFF050K12+ GCCTTCGTAATCACGGCCAGGGTCTCCAAATTGGGCAACCGATGGAACGCGATGGACTCG
                      ____________________________________________________________
consensus GCCTTCGTAATCACGGCCAGGGTCTCCAAATTGGGCAACCGATGGAACGCGATGGACTCG
 
. : . : . : . : . : . :
JMSF023C06+ GAGAGCGATAAAAGCAGCTCCCGCGACGCGATCACCTCCATTGCCAGCATAGCCCCCTTG
JMFS134A04+ GAGAGCGATAAAAGCAGCTCCCGCGACGCGATCACCTCCATTGCCAGCATAGCCCTCTTG
JMFS091F05+ GAGAGCGATAAAAGCAGCTCCCGCGACGCGATCACCTCCATTGCCAGCATAGCCCTCTTG
JMFS096C08+ GAGAGCGATAAAAGCAGCTCCCGCGACGCGATCACCTCCATTGCCAGCATAGCCCTCTTG
JMFF010J09+ GAGAGCGATAAAAGCAGCTCCCGCGACGCGATCACCTCCATTGCCAGCATAGCCCTCTTG
JMSF033J15+ GAGAGCGATAAAAGCAGCTCCCGCGACGCGATCACCTCCATTGCCAGCATAGCCCTCTTG
JMFF005E07+ ATAGCCCTCTTG
JMFF050K12+ GAGAGCGATAAAAGCAGCTCCCGCGACGCGATCACCTCCATTGCCAGCATAGCCCTCTTG
                      ____________________________________________________________
consensus GAGAGCGATAAAAGCAGCTCCCGCGACGCGATCACCTCCATTGCCAGCATAGCCCTCTTG
 
. : . : . : . : . : . :
JMSF023C06+ GAGAATCCGTTCACAGTCCGTTCCAGGACGTAGCGTTCCTTGCGAAGCTCTGAGGTGTGG
JMFS134A04+ GAGAATCCGTTCACAGTCCGTTCCAGGACGTAGCGTTCCTTGCGAAGCTCTGAGGTGTGG
JMFS091F05+ GAGAATCCGTTCACAGTCCGTTCCAGGACGTAGCGTTCCTTGCGAAGCTCTGAGGTGTGG
JMFS096C08+ GAGAATCCGTTCACAGTCCGTTCCAGGACGTAGCGTTCCTTGCGAAGCTCTGAGGTGTGG
JMFF010J09+ GAGAATCCGTTCACAGTCCGTTCCAGGACGTAGCGTTCCTTGCGAAGCTCTGAGGTGTGG
JMSF033J15+ GAGAATCCGTTCACAGTCCGTTCCAGGACGTAGCGTTCCTTGCGAAGCTCTGAGGTGTGG
JMFF005E07+ GAGAATCCGTTCACAGTCCGTTCCAGGACGTAGCGTTCCTTGCGAAGCTCTGAGGTGTGG
JMFF050K12+ GAGAATCCGTTCACAGTCCGTTCCAGGACGTAGCGTTCCTTGCGAAGCTCTGAGGTGTGG
                      ____________________________________________________________
consensus GAGAATCCGTTCACAGTCCGTTCCAGGACGTAGCGTTCCTTGCGAAGCTCTGAGGTGTGG
 
. : . : . : . : . : . :
JMSF023C06+ TGATGGAACTCCGACGCCGTCGACCGGTCGGAGCGGGTGGATTCGGGTACGTACACGCGG
JMFS134A04+ TGATGGAACTCCGACGCCGTCGACCGGTCGGAGCGGGTGGATTCGGGTACGTACACGCGG
JMFS091F05+ TGATGGAACTCCGACGCCGTCGACCGGTCGGAGCGGGTGGATTCGGGTACGTACACGCGG
JMFS096C08+ TGATGGAACTCCGACGCCGTCGACCGGTCGGAGCGGGTGGATTCGGGTACGTACACGCGG
JMFF010J09+ TGATGGAACTCCGACGCCGTCGACCGGTCGGAGCGGGTGGATTCGGGTACGTACACGCGG
JMSF033J15+ TGATGGAACTCCGACGCCGTCGACCGGTCGGAGCGGGTGGATTCGGGTACGTACACGCGG
JMFF005E07+ TGATGGAACTCCGACGCCGTCGACCGGTCGGAGCGGGTGGATTCGGGTACGTACACGCGG
JMFF050K12+ TGATGGAACTCCGACGCCGTCGACCGGTCGGAGCGGGTGGATTCGGGTACGTACACGCGG
                      ____________________________________________________________
consensus TGATGGAACTCCGACGCCGTCGACCGGTCGGAGCGGGTGGATTCGGGTACGTACACGCGG
 
. : . : . : . : . : . :
JMSF023C06+ AGCGATCCATCCGAGCAGACGATGAATAAGTTTGAGCCGTACGATTCGACGGCGTCGATC
JMFS134A04+ AGCGATCCATCCGAGCAGACGATGAATAAGTTTGAGCCGTACGATTCGACGGCGTCGATC
JMFS091F05+ AGCGATCCATCCGAGCAGACGATGAATAAGTTTGAGCCGTACGATTCGACGGCGTCGATC
JMFS096C08+ AGCGATCCATCCGAGCAGACGATGAATAAGTTTGAGCCGTACGATTCGACGGCGTCGATC
JMFF010J09+ AGCGATCCATCCGAGCAGACGATGAATAAGTTTGAGCCGTACGATTCGACGGCGTCGATC
JMSF033J15+ AGCGATCCATCCGAGCAGACGATGAATAAGTTTGAGCCGTACGATTCGACGGCGTCGATC
JMFF005E07+ AGCGATCCATCCGAGCAGACGATGAATAAGTTTGAGCCGTACGATTCGACGGCGTCGATC
JMFF050K12+ AGCGATCCATCCGAGCAGACGATGAATAAGTTTGAGCCGTACGATTCGACGGCGTCGATC
                      ____________________________________________________________
consensus AGCGATCCATCCGAGCAGACGATGAATAAGTTTGAGCCGTACGATTCGACGGCGTCGATC
 
. : . : . : . : . : . :
JMSF023C06+ TTCGTGGGGCAATCATTGAGGAGCACGAATGAGTCGTAAGCGCTATGCACCATTGTTGCT
JMFS134A04+ TTCGTGGGGCAATCATTGAGGAGCACGAATGAGTCGTAAGCGCTATGCACCATTGTTGCT
JMFS091F05+ TTCGTGGGGCAATCATTGAGGAGCACGAATGAG
JMFS096C08+ TTCGTGGGGCAATCATTGAGGAGCACGAATGAGTCGTAAGCGCTATGCACCATTGTTGCT
JMFF010J09+ TTCGTGGGGCAATCATTGAGGAGCACGAATGAGTCGTAAGCGCTATGCACCATTGTTGCT
JMSF033J15+ TTCGTGGGGCAATCATTGAGGAGCACGAATGAGTCGTAAGCGCTATGCACCATTGTTGCT
JMFF005E07+ TTCGTGGGGCAATCATTGAGGAGCACGAATGAGTCGTAAGCGCTATGCACCATTGTTGCT
JMFF050K12+ TTCGTGGGGCAATCATTGAGGAGCACGAATGAGTCGTAAGCGCTATGCACCATTGTTGCT
                      ____________________________________________________________
consensus TTCGTGGGGCAATCATTGAGGAGCACGAATGAGTCGTAAGCGCTATGCACCATTGTTGCT
 
. : . : . : . : . : . :
JMSF023C06+ CTCTCC
JMFS134A04+ CTC
JMFS096C08+ CTCT
JMFF010J09+ CTCTCCCCT
JMSF033J15+ CTCTCCCCTGTCGATCGCT
JMFF005E07+ CTCTCCCCTGTCGATCGCTGAGCTTTCTCAGACGAAAAAGTTGCCAAACTGGCAAAGGT
JMFF050K12+ CTCTCCCCTGTCGATCGCTGAGCTTTCTCAGACGAAAAAGTTGCCAAACTGGCAAAGGTC
                      ____________________________________________________________
consensus CTCTCCCCTGTCGATCGCTGAGCTTTCTCAGACGAAAAAGTTGCCAAACTGGCAAAGGTC