Previous Contig 002164:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050K11Sequence635002164 (2)544011011 (10)
JMFS163F02Sequence608002164 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS163F02+ TGAATTAGACGAAGCAACTGCGGCGGCAC
JMFF050K11+ TTAGACGGAGCAACTGCGGCGGCAC
                      ____________________________________________________________
consensus TGAATTAGACGGAGCAACTGCGGCGGCAC
 
. : . : . : . : . : . :
JMFS163F02+ CTTCGGCCGCGGAAACAGAATCAGCCCACGATGTTGGCATACTCTCAAAGGCGAATCAAA
JMFF050K11+ TTTCGGCCGCGGAAACAGAATCAGCCCACGATGTTGGCATACTCTCAAAGGCGAATCAAA
                      ____________________________________________________________
consensus TTTCGGCCGCGGAAACAGAATCAGCCCACGATGTTGGCATACTCTCAAAGGCGAATCAAA
 
. : . : . : . : . : . :
JMFS163F02+ CAAAAAGCACCAATTTTTATTGTTTTCTCTCCTCCAAAACCCTCAATTTCAAAAATTAAA
JMFF050K11+ CAAAAAGCACCAATTTTTATTGTTTTCTCTCCTCCAAAACCCTCAATTTCAAAAATTAAA
                      ____________________________________________________________
consensus CAAAAAGCACCAATTTTTATTGTTTTCTCTCCTCCAAAACCCTCAATTTCAAAAATTAAA
 
. : . : . : . : . : . :
JMFS163F02+ CTCACGCAACCCGTGATCCAACCGGTGAATTGAAACAAAGATTCTCACTTTATTATTATC
JMFF050K11+ CTCACGCAACCCGTGATCCAACCGGTGAATTGAAACAAAGATTCTCACTTTATTATTATC
                      ____________________________________________________________
consensus CTCACGCAACCCGTGATCCAACCGGTGAATTGAAACAAAGATTCTCACTTTATTATTATC
 
. : . : . : . : . : . :
JMFS163F02+ GACAAACGTCAAATGAAAACCCTCACAATTTTCGTCAGCATCAAACAACAAAACCCAAAT
JMFF050K11+ GACAAACGTCAAATGAAAACCCTCACAATTTTCGTCAGCATCAAACAACAAAACCCAAAT
                      ____________________________________________________________
consensus GACAAACGTCAAATGAAAACCCTCACAATTTTCGTCAGCATCAAACAACAAAACCCAAAT
 
. : . : . : . : . : . :
JMFS163F02+ CCTTGTTCTTTTTCCTCGTTCTCGAAGCTTCACATCAGAAAGAAAACCCTGGCACACAAC
JMFF050K11+ CCTTGTTCTTTTTCCTCGTTCTCGAAGCTTCACATCAGAAAGAAAACCCTGGCACACAAC
                      ____________________________________________________________
consensus CCTTGTTCTTTTTCCTCGTTCTCGAAGCTTCACATCAGAAAGAAAACCCTGGCACACAAC
 
. : . : . : . : . : . :
JMFS163F02+ ATTCAAAATCACAAAAATGCAGATCCAGAAATCAACATTAGTCAACACCAATTCAAAACC
JMFF050K11+ ATTCAAAATCACAAAAATGCAGATCCAGAAATCAACATTAGTCAACACCAATTCAAAACC
                      ____________________________________________________________
consensus ATTCAAAATCACAAAAATGCAGATCCAGAAATCAACATTAGTCAACACCAATTCAAAACC
 
. : . : . : . : . : . :
JMFS163F02+ CACACAAGTCAAAAGGCTAAAATCACGCTACGAAATACAAATTAAAAATATATATATACA
JMFF050K11+ CACACAAGTCAAAAGGCTAAAATCACGCTACGAAATACAAATTAAAAATATATATATACA
                      ____________________________________________________________
consensus CACACAAGTCAAAAGGCTAAAATCACGCTACGAAATACAAATTAAAAATATATATATACA
 
. : . : . : . : . : . :
JMFS163F02+ CATCAACGAATACCCAGACACGACAGACAAAGAACAAACCACAGCATAACTACATGTATA
JMFF050K11+ CATCAACGAATACCCAGACACGACAGACAAAGAACAAACCACAGCATAACTACATGTATA
                      ____________________________________________________________
consensus CATCAACGAATACCCAGACACGACAGACAAAGAACAAACCACAGCATAACTACATGTATA
 
. : . : . : . : . : . :
JMFS163F02+ TTTCTAAACCCAAAATTGAAGACAGATAAACAAGATTAAGGTGGCGTACGACGGAAGGGA
JMFF050K11+ TTTCTAAACCCAAAATTGAAGACAGATAAACAAGATTAAGGTGGCGTACGACGGAAGGGA
                      ____________________________________________________________
consensus TTTCTAAACCCAAAATTGAAGACAGATAAACAAGATTAAGGTGGCGTACGACGGAAGGGA
 
. : . : . : . : . : . :
JMFS163F02+ AGAAACCCTAAAGTTGCGATCTTTGGAGGGGAAGAGAGG
JMFF050K11+ AGAAACCCTAAAGTTGCGATCTTTGGAGGGGAAGAGAGGGAGGGAGGCAAAAATATCTTT
                      ____________________________________________________________
consensus AGAAACCCTAAAGTTGCGATCTTTGGAGGGGAAGAGAGGGAGGGAGGCAAAAATATCTTT