Previous Contig 002142:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019L04Sequence596002142 (3)799010971 (3)gb:T3F20_17240276e-27Sequence of BAC T3F20 from Arabidopsis thaliana chromosome 1, complete sequence.
JMFF050D14Sequence617002142 (3)gb:AP003628_18317090.018Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047611010971 (3)gb:T3F20_17240272e-05Sequence of BAC T3F20 from Arabidopsis thaliana chromosome 1, complete sequence.
JMFS129B02Sequence530002142 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS129B02+ GAACCCGCGTCCACNCCGTGGAGCCATTGC
                      ____________________________________________________________
consensus GAACCCGCGTCCACNCCGTGGAGCCATTGC
 
. : . : . : . : . : . :
JMFS129B02+ CCCTCTTCCCCTCCCACCATCATCATCACCTCTAGACAGTATCCCAACTGCCTTTTTAAC
                      ____________________________________________________________
consensus CCCTCTTCCCCTCCCACCATCATCATCACCTCTAGACAGTATCCCAACTGCCTTTTTAAC
 
. : . : . : . : . : . :
JMFS129B02+ TGCTTCCTCCCTGCTCAATCTTGGGCTGGGAAGCTTGCTAGATTCAGCTTGAGGAGTTTT
JMFF050D14+ GGAGTTTT
                      ____________________________________________________________
consensus TGCTTCCTCCCTGCTCAATCTTGGGCTGGGAAGCTTGCTAGATTCAGCTTGAGGAGTTTT
 
. : . : . : . : . : . :
JMFS129B02+ CCTCGCCCGTAGATGCCGGTTTTCTTCCTTAGG-TTTTCTGAAACAGGAGGTGTTACTGT
JMFF019L04+ CGCCNGTAGATGCCGGTTTTCTTCCTTAGGTTTTTCTGAAACAGGAGGTGTTACTGT
JMFF050D14+ CCTCGCCCGTAGATGCCGGTTTTCTTCCTTAGGTTTTTCTGAAACAGGAGGTGTTACTGT
                      ____________________________________________________________
consensus CCTCGCCCGTAGATGCCGGTTTTCTTCCTTAGGTTTTTCTGAAACAGGAGGTGTTACTGT
 
. : . : . : . : . : . :
JMFS129B02+ GGGCTTTCCACGCCCAGCACCGGATAGCACAGAAAGGATACTCGAAGGGAGACTGGAATC
JMFF019L04+ GGGCTTTCCACGCCCAGCACCGGATAGCACAGAAAGGATACTCGAAGGGAGACTGGAATC
JMFF050D14+ GGGCTTTCCACGCCCAGCACCGGATAGCACAGAAAGGATACTCGAAGGGAGACTGGAATC
                      ____________________________________________________________
consensus GGGCTTTCCACGCCCAGCACCGGATAGCACAGAAAGGATACTCGAAGGGAGACTGGAATC
 
. : . : . : . : . : . :
JMFS129B02+ CGCAGACGCTTTGGTTTGGGAATCCGAAGACTCTTCTCCTGCCACGAAGAACTTATGTTG
JMFF019L04+ CGCAGACGCTTTGGTTTGGGAATCCGAAGACTCTTCTCCTGCCACGAAGAACTTATGTTG
JMFF050D14+ CGCAGACGCTTTGGTTTGGGAATCCGAAGACTCTTCTCCTGCCACGAAGAACTTATGTTG
                      ____________________________________________________________
consensus CGCAGACGCTTTGGTTTGGGAATCCGAAGACTCTTCTCCTGCCACGAAGAACTTATGTTG
 
. : . : . : . : . : . :
JMFS129B02+ CGGCTGTTGCAGTGACATCCGCTGTTGGGATGGTGATGGAACAGAAATTGGTAAGGGAAC
JMFF019L04+ CGGCTGTTGCAGTGACATCCGCTGTTGGGATGGTGATGGAACAGAAATTGGTAAGGGAAC
JMFF050D14+ CGGCTGTTGCAGTGACATCCGCTGTTGGGATGGTGATGGAACAGAAATTGGTAAGGGAAC
                      ____________________________________________________________
consensus CGGCTGTTGCAGTGACATCCGCTGTTGGGATGGTGATGGAACAGAAATTGGTAAGGGAAC
 
. : . : . : . : . : . :
JMFS129B02+ ACCTCGGCCGTGGCCAGCGGGGGTGGCGGCAGAAGCATTACCCGCCACAAACTGATCTGA
JMFF019L04+ ACCTCGGCCGTGGCCAGCGGGGGTGGCGGCAGAAGCATTACCCGCCACAAACTGATCTGA
JMFF050D14+ ACCTCGGCCGTGGCCAGCGGGGGTGGCGGCAGAAGCATTACCCGCCACAAACTGATCTGA
                      ____________________________________________________________
consensus ACCTCGGCCGTGGCCAGCGGGGGTGGCGGCAGAAGCATTACCCGCCACAAACTGATCTGA
 
. : . : . : . : . : . :
JMFS129B02+ GGAGGAGAAGGAAGAGGGGAAGGGCTTACCGCTTCCACGGCCATGCCCAATTCCACTCGG
JMFF019L04+ GGAGGAGAAGGAAGAGGGGAAGGGCTTACCGCTTCCACGGCCATGCCCAATTCCACTCGG
JMFF050D14+ GGAGGAGAAGGAAGAGGGGAAGGGCTTACCGCTTCCACGGCCATGCCCAATTCCACTCGG
                      ____________________________________________________________
consensus GGAGGAGAAGGAAGAGGGGAAGGGCTTACCGCTTCCACGGCCATGCCCAATTCCACTCGG
 
. : . : . : . : . : . :
JMFS129B02+ TGGCTGTGGGGCAGCAGCTGA
JMFF019L04+ TGGCTGTGGGGCAGCAGCTGACTTATCATCCTTCGCATCATTGTTAGGAGTAAATCCAAA
JMFF050D14+ TGGCTGTGGGGCAGCAGCTGACTTATCATCCTTCGCATCATTGTTAGGAGTAAATCCAAA
                      ____________________________________________________________
consensus TGGCTGTGGGGCAGCAGCTGACTTATCATCCTTCGCATCATTGTTAGGAGTAAATCCAAA
 
. : . : . : . : . : . :
JMFF019L04+ GATGGGGGAGTTGTCGGAGCCAAATCCACCACCTCCACGACCTCGGCCGCCTCCGCCGCC
JMFF050D14+ GATGGGGGAGTTGTCGGAGCCAAATCCACCACCTCCACGACCTCGGCCGCCTCCGCCGCC
                      ____________________________________________________________
consensus GATGGGGGAGTTGTCGGAGCCAAATCCACCACCTCCACGACCTCGGCCGCCTCCGCCGCC
 
. : . : . : . : . : . :
JMFF019L04+ AGTGGAAGTTGAGAATGCGGAAGAAATGAAGGATTGCCGGGCGGAGATTGTGCAGCAGCG
JMFF050D14+ AGTGGAAGTTGAGAATGCGGAAGAAATGAAGGATTGCCGGGCGGAGATTGTGCAGCAGCG
                      ____________________________________________________________
consensus AGTGGAAGTTGAGAATGCGGAAGAAATGAAGGATTGCCGGGCGGAGATTGTGCAGCAGCG
 
. : . : . : . : . : . :
JMFF019L04+ TGGAAGCTTTCCCCAGCTGTGTCTCATGTCTAAATCCCAATTCGTTGCAAACACAAACT
JMFF050D14+ TGGAAGCTTTCCCCAGCTGTGTCTCATGTCTAAATCCCAATTCG-TGCAAACACAAACTC
                      ____________________________________________________________
consensus TGGAAGCTTTCCCCAGCTGTGTCTCATGTCTAAATCCCAATTCGTTGCAAACACAAACTC