Previous Contig 002139:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050B18Sequence570002139 (2)gb:AB018113_15137911e-13Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFC19.612021885gb:AY074839_15676923e-40Arabidopsis thaliana AT5g45420/MFC19_9 mRNA, complete cds.>gb:AF367345_1791797 A
JMFN033J09Sequence500002139 (2)gb:AY074839_15676922e-06Arabidopsis thaliana AT5g45420/MFC19_9 mRNA, complete cds.>gb:AF367345_1791797 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050B18+ TCCCGGCTTGCCCACAGGATGCTTCCCCAAC
                      ____________________________________________________________
consensus TCCCGGCTTGCCCACAGGATGCTTCCCCAAC
 
. : . : . : . : . : . :
JMFN033J09+ CACCTCCACATCTCCTTCGCTCCAATCCTTCTCCTCCACCACTCCATTC
JMFF050B18+ AACTTCCTCAACACCTCCACATCTCCTTCGCTCCAATCCTTCTCCTCCACCACTCCATTC
                      ____________________________________________________________
consensus AACTTCCTCAACACCTCCACATCTCCTTCGCTCCAATCCTTCTCCTCCACCACTCCATTC
 
. : . : . : . : . : . :
JMFN033J09+ CCCAATTTCAATTTCCCCTCACTTTTCTCGGTCGACCCGTTGATCTTTACGGGTTCTGGA
JMFF050B18+ CCCAATTTCAATTTCCCCTCACTTTTCTCGGTCGACCCGTTGATC-TTACGGGTTCTGGA
                      ____________________________________________________________
consensus CCCAATTTCAATTTCCCCTCACTTTTCTCGGTCGACCCGTTGATCTTTACGGGTTCTGGA
 
. : . : . : . : . : . :
JMFN033J09+ GCATGGGTGGCAATAGACCCAGATCCGGATTCAATGGACTTCCTAACGGGTTTCCCTGAT
JMFF050B18+ GCATGGGTGGCAATAGACCCAGATCCGGATTCAATGGACTTCCTAACGGGTTTCCCTGAT
                      ____________________________________________________________
consensus GCATGGGTGGCAATAGACCCAGATCCGGATTCAATGGACTTCCTAACGGGTTTCCCTGAT
 
. : . : . : . : . : . :
JMFN033J09+ CTCTTACCGGATTTCTTATTTTCAGGCTCAGCATCAATGGGATCGTTGAATTGGACAGGA
JMFF050B18+ CTCTTACCGGATTTCTTATTTTCAGGCTCAGCATCAATGGGATCGTTGAATTGGACAGGA
                      ____________________________________________________________
consensus CTCTTACCGGATTTCTTATTTTCAGGCTCAGCATCAATGGGATCGTTGAATTGGACAGGA
 
. : . : . : . : . : . :
JMFN033J09+ GGGCCGACCCCGACACGGATATCGCCGGCGGTGATGGACAGCGGCGCAAAGGGGCCAATG
JMFF050B18+ GGGCCGACCCCGACACGGATATCGCCGGCGGTGATGGACAGCGGCGCAAAGGGGCCAATG
                      ____________________________________________________________
consensus GGGCCGACCCCGACACGGATATCGCCGGCGGTGATGGACAGCGGCGCAAAGGGGCCAATG
 
. : . : . : . : . : . :
JMFN033J09+ AGGAGGGAAATTGAAAGCCATAAAAGGATGGATCTCAGAGGCTCAGAGGTGAAGTAAAAT
JMFF050B18+ AGGAGGGAAATTGAAAGCCATAAAAGGATGGATCTCAGAGGCTCAGAGGTGAAGTAAAAT
                      ____________________________________________________________
consensus AGGAGGGAAATTGAAAGCCATAAAAGGATGGATCTCAGAGGCTCAGAGGTGAAGTAAAAT
 
. : . : . : . : . : . :
JMFN033J09+ AGGGAGAGAACAAGAAGAGGGATGGAGAGAGAGAGGGAGATGAAGAGAGTAGGTCGGTGT
JMFF050B18+ AGGGAGAGAACAAGAAGAGGGATGGAGAGAGAGAGGGAGATGAAGAGAGTAGGTCGGTGT
                      ____________________________________________________________
consensus AGGGAGAGAACAAGAAGAGGGATGGAGAGAGAGAGGGAGATGAAGAGAGTAGGTCGGTGT
 
. : . : . : . : . : . :
JMFN033J09+ AGAGAGGGTTTTAGAGGATGTGAATCGTCGTCGGCGGCGGCGGCATGGGATTGAGGTAAG
JMFF050B18+ AGAGAGGGTTTTAGAGGATGTGAATCGTCGTCGGAGGCGGCGGCATGGGATTGAGGTAAG
                      ____________________________________________________________
consensus AGAGAGGGTTTTAGAGGATGTGAATCGTCGTCGGCGGCGGCGGCATGGGATTGAGGTAAG
 
. : . : . : . : . : . :
JMFN033J09+ GGCTTGGAGTGGAGGACAAATCTGGGTCTGG
JMFF050B18+ GGCTTGGAGTGGAGGACAAATCTGGGTCTGGCGTCCTCGTCCAGAAACTCCATGGTCAAT
                      ____________________________________________________________
consensus GGCTTGGAGTGGAGGACAAATCTGGGTCTGGCGTCCTCGTCCAGAAACTCCATGGTCAAT