Previous Contig 002138:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022L19Sequence488002138 (8)gb:AY056197_15635214e-40Arabidopsis thaliana unknown protein (At3g11700) mRNA, complete cds.>gb:AY058879699002431 (8)gb:AY093189_15751438e-43Arabidopsis thaliana unknown protein (At2g35860) mRNA, complete cds.>gb:BT006590
JMFF043I24Sequence631002138 (8)gb:BT015342_16421703e-49Arabidopsis thaliana At5g06390 gene, complete cds.>gb:BT020253_1642648 Arabidops576002431 (8)gb:AY093189_15751433e-14Arabidopsis thaliana unknown protein (At2g35860) mRNA, complete cds.>gb:BT006590
JMFF044B06Sequence628002138 (8)gb:BT015342_16421705e-50Arabidopsis thaliana At5g06390 gene, complete cds.>gb:BT020253_1642648 Arabidops577002431 (8)gb:AY093189_15751433e-14Arabidopsis thaliana unknown protein (At2g35860) mRNA, complete cds.>gb:BT006590
JMFF050B16Sequence578002138 (8)gb:BT015342_16421707e-40Arabidopsis thaliana At5g06390 gene, complete cds.>gb:BT020253_1642648 Arabidops
JMFF051H12Sequence593002138 (8)gb:BT015342_16421702e-44Arabidopsis thaliana At5g06390 gene, complete cds.>gb:BT020253_1642648 Arabidops435002431 (8)
JMFF051H13Sequence594002138 (8)gb:BT015342_16421704e-42Arabidopsis thaliana At5g06390 gene, complete cds.>gb:BT020253_1642648 Arabidops541002431 (8)gb:AY093189_15751432e-07Arabidopsis thaliana unknown protein (At2g35860) mRNA, complete cds.>gb:BT006590
JMFS053G11Sequence593002138 (8)gb:BT015342_16421704e-47Arabidopsis thaliana At5g06390 gene, complete cds.>gb:BT020253_1642648 Arabidops
JMSF005G22Sequence277002138 (8)pir|T46107|T461071e-16hypothetical protein T25B15.140 - Arabidopsis thaliana>gb:ATT25B15_1555444 Arabi110007791 (14)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS053G11+ NAAGTCCTTGACNNGGCTTNCGCCGTCGAAGCGGTGGTGGTGGCCGCCGGGGCCCGGGG
                      ____________________________________________________________
consensus NAAGTCCTTGACNNGGCTTNCGCCGTCGAAGCGGTGGTGGTGGCCGCCGGGGCCCGGGG
 
. : . : . : . : . : . :
JMFS053G11+ CGGGCGCGGGAGCTATAGATGGGCCGGGGGCCATGGCGTCGTAGATGGGGAGAACGGGAG
                      ____________________________________________________________
consensus CGGGCGCGGGAGCTATAGATGGGCCGGGGGCCATGGCGTCGTAGATGGGGAGAACGGGAG
 
. : . : . : . : . : . :
JMFS053G11+ GGGCGCCGGCGGGGACCGGGCCGGCGGGTTTCTTGAGACGGTGAGTCCTGGGGTCCACCT
                      ____________________________________________________________
consensus GGGCGCCGGCGGGGACCGGGCCGGCGGGTTTCTTGAGACGGTGAGTCCTGGGGTCCACCT
 
. : . : . : . : . : . :
JMFS053G11+ CAGGGGCGCCGGTGGGGAGGACGGCGGAGATGGACCGCAAGCTCCGCCGCGTGTTGAAAT
                      ____________________________________________________________
consensus CAGGGGCGCCGGTGGGGAGGACGGCGGAGATGGACCGCAAGCTCCGCCGCGTGTTGAAAT
 
. : . : . : . : . : . :
JMFS053G11+ CTTGCTGCACCGACTTGGGGATCAACACGCGCTCGATCCCGTGGATGATGCCGTCGGGGC
JMFF044B06+ TGGGGATCAACACGCGCTCGATCCCGTGGATGATGCCGTCGGGGC
JMFF051H13+ GATGATGCCGTC-GGGC
JMFF051H12+ GATGATGCCGTCGGGGC
JMFF043I24+ TGGGGATCAACACGCGCTCGATCCCGTGGATGATGCCGTCGGGGC
                      ____________________________________________________________
consensus CTTGCTGCACCGACTTGGGGATCAACACGCGCTCGATCCCGTGGATGATGCCGTCGGGGC
 
. : . : . : . : . : . :
JMFS053G11+ GAACGACGTCGTCGAGGGAAACAACCTTCGCGCCGCTCACCTCCCTCTCCGACACAACGA
JMFF044B06+ GAACGACGTCGTCGAGGGAAACAACCTTCGCGCCGCTCACCTCCCTCTCCGACACAACGA
JMFF051H13+ GAACGACGTCGTCGAGGGAAACAACCTTCGCGCCGCTCACCTCCCTTTCCGACACAACGA
JMFF051H12+ GAACGACGTCGTCGAGGGAAACAACCTTCGCGCGNCTCACCTCCCTTTCNGACACAACGA
JMFF043I24+ GAACGACGTCGTCGAGGGAAACAACCTTCGCGCCGCTCACCTCCCTCTCCGACACAACGA
                      ____________________________________________________________
consensus GAACGACGTCGTCGAGGGAAACAACCTTCGCGCCGCTCACCTCCCTCTCCGACACAACGA
 
. : . : . : . : . : . :
JMFS053G11+ GATTCTCCCCTCCGGCGTCGCGGCACAGAGTTATATGATTCCGGCCGCCCCGCCGCGAGT
JMFF044B06+ GATTCTCCCCTCCGGCGTCGCGGCACAGAGTTATATGATTCCGGCCGCCCCGCCGCGAGT
JMFF051H13+ GATTCTCCCCTCCGGCGTCGCGGCACAGAGTTATATGATTCCGGCCGCCCCGCCGCGAGT
JMFF051H12+ GATTCTCCCCTCCGGCGTCGCGGCACAGAGTTATATGATTCCGGCCGCCCCGCCGCGAGT
JMFF022L19+ GGCACAGAGTTATATGATTCCGGCCGCCCCGCCGCGAGT
JMFF043I24+ GATTCTCCCCTCCGGCGTCGCGGCACAGAGTTATATGATTCCGGCCGCCCCGCCGCGAGT
JMFF050B16+ GCACAGAGTTATATGATTCCGGCCGCCCCGCCGCGAGT
                      ____________________________________________________________
consensus GATTCTCCCCTCCGGCGTCGCGGCACAGAGTTATATGATTCCGGCCGCCCCGCCGCGAGT
 
. : . : . : . : . : . :
JMFS053G11+ TTTCCGGCCAGTGTTTGGACTCAATGCGAGTGGGAATCATGTGGAAGAGAAGGAGATTCT
JMFF044B06+ TTTCCGGCCAGTGTTTGGACTCAATGCGAGTGGGAATCATGTGGAAGAGAAGGAGATTCT
JMFF051H13+ TTTCCGGCCAGTGTTTGGACTCAATGCGAGTGGGAATCATGTGGAAGAGAAGGAGATTCT
JMFF051H12+ TTTCCGGCCAGTGTTTGGACTCAATGCGAGTGGGAATCATGTGGAAGAGAAGGAGATTCT
JMFF022L19+ TTTCCGGCCAGTGTTTGGACTCAATGCGAGTGGGAATCATGTGGAAGAGAAGGAGATTCT
JMFF043I24+ TTTCCGGCCAGTGTTTGGACTCAATGCGAGTGGGAATCATGTGGAAGAGAAGGAGATTCT
JMFF050B16+ TTCCGGGCCAGTGTTGGGACTCAATGCGAGTGGGAATCATGTGGAAGAGAAGGAGATTCT
                      ____________________________________________________________
consensus TTTCCGGCCAGTGTTTGGACTCAATGCGAGTGGGAATCATGTGGAAGAGAAGGAGATTCT
 
. : . : . : . : . : . :
JMFS053G11+ GCAGGGACCTGAGATTCCCAGGCTGAAGCAAGAAGCGCTTGAACTCCGGGTCCAAATCCC
JMFF044B06+ GCAGGGACCTGAGATTCCCAGGCTGAAGCAAGAAGCGCTTGAACTCCGGGTCCAAATCCC
JMFF051H13+ GCAGGGACCTGAGATTCCCAGGCTGAAGCAAGAAGCGCTTGAACTCCGGGTCCAAATCCC
JMFF051H12+ GCAGGGACCTGAGATTCCCAGGCTGAAGCAAGAAGCGCTTGAACTCCGGGTCCAAATCCC
JMFF022L19+ GCAGGGACCTGAGATTCCCAGGCTGAAGCAAGAAGCGCTTGAACTCCGGGTCCAAATCCC
JMFF043I24+ GCAGGGACCTGAGATTCCCAGGCTGAAGCAAGAAGCGCTTGAACTCCGGGTCCAAATCCC
JMFF050B16+ GCAGGGACCTGAGATTCCCAGGCTGAAGCAAGAAGCGCTTGAACTCCGGGTCCAAATCCC
                      ____________________________________________________________
consensus GCAGGGACCTGAGATTCCCAGGCTGAAGCAAGAAGCGCTTGAACTCCGGGTCCAAATCCC
 
. : . : . : . : . : . :
JMFS053G11+ GCTCCAAAGCCTCATTCCTGGGCGCAAAAATGGTGATATTGGGCCGGGAAACAG
JMFF044B06+ GCTCCAAAGCCTCATTCCTGGGCGCAAAAATGGTGATATTGTGCCGGGAAACAGCTTCCT
JMFF051H13+ GCTCCAAAGCCTCATTCCTGGGCGCAAAAATGGTGATATTGTGCCGGGAAACAGCTTCCT
JMFF051H12+ GCTCCAAAGCCTCATTCCTGGGCGCAAAAATGGTGATATTGTGCCGGGAAACAGCTTCCT
JMSF005G22+ GGCGCAAAAATGGTGATATTGTGGCGGGAAACAGCTTCCT
JMFF022L19+ GCTCCAAAGCCTCATTCCTGGGCGCAAAAATGGTGATATTGTGCCGGGAAACAGCTTCCT
JMFF043I24+ GCTCCAAAGCCTCATTCCTGGGCGCAAAAATGGTGATATTGTGCCGGGAAACAGCTTCCT
JMFF050B16+ GCTCCAAAGCCTCATTCCTGGGCGCAAAAATGGTGATATTGTGCCGGGAAACAGCTTCCT
                      ____________________________________________________________
consensus GCTCCAAAGCCTCATTCCTGGGCGCAAAAATGGTGATATTGTGCCGGGAAACAGCTTCCT
 
. : . : . : . : . : . :
JMFF044B06+ CAAGAGTCTGGAGAAGAAGCGCCTTCTCCACCAGCTCCGACAGCTCCGTGTAGTGCGAAT
JMFF051H13+ CAAGAGTCTGGAGAAGAAGCGCCTTCTCCACCAGCTCCGACAGCTCCGTGTAGTGCGAAT
JMFF051H12+ CAAGAGTCTGGAGAAGAAGCGCCTTCTCCACCAGCTCCGACAGCTCCGTGTAGTGCGAAT
JMSF005G22+ CGAGAGTCTGCAGCAAAAGCGCCTTCTCCACGAGCTCAGACAGCTCGGTATAATGCGAAT
JMFF022L19+ CAAGAGTCTGGAGAAGAAGCGCCTTCTCCACCAGCTCCGACAGCTCCGTGTAGTGCGAAT
JMFF043I24+ CAAGAGTCTGGAGAAGAAGCGCCTTCTCCACCAGCTCCGACAGCTCCGTGTAGTGCGAAT
JMFF050B16+ CAAGAGTCTGGAGAAGAAGCGCCTTCTCCACCAGCTCCGACAGCTCCGTGTAGTGCGAAT
                      ____________________________________________________________
consensus CAAGAGTCTGGAGAAGAAGCGCCTTCTCCACCAGCTCCGACAGCTCCGTGTAGTGCGAAT
 
. : . : . : . : . : . :
JMFF044B06+ CCAGAAGGGCCACCAACACCGAGTTGGAATTGATCTGAGCGCCGGAGCTGAGATTTCTTG
JMFF051H13+ CCAGAAGGGCCACCAACACCGAGTTGGAATTGATCTGAGCGCCGGAGCTGAGATTTCTTG
JMFF051H12+ CCAGAAGGGCCACCAACACCGAGTTGGAATTGATCTGAGCGCCGGAGCTGAGATTTCTTG
JMSF005G22+ CCAGAAGCGCCACCAACACCGAGTTAGAATTGATCTGAGC
JMFF022L19+ CCAGAAGGGCCACCAACACCGAGTTGGAATTGATCTGAGCGCCGGAGCTGAGATTTCTTG
JMFF043I24+ CCAGAAGGGCCACCAACACCGAGTTGGAATTGATCTGAGCGCCGGAGCTGAGATTTCTTG
JMFF050B16+ CCAGAAGGGCCACCAACACCGAGTTGGAATTGATCTGAGCGCCGGAGCTGAGATTTCTTG
                      ____________________________________________________________
consensus CCAGAAGGGCCACCAACACCGAGTTGGAATTGATCTGAGCGCCGGAGCTGAGATTTCTTG
 
. : . : . : . : . : . :
JMFF044B06+ ATGGGTTTTCGTGCAATGCTGCGCCACCCACTAACCCAAACACCAACAAAAACACACTAA
JMFF051H13+ ATGGGTTTTCGTGCAATGCTGCGCCACCCACTAACCCAAACACCAACAAAAACACACTAA
JMFF051H12+ ATGGGTTTTCGTGCAATGCTGCGCCACCCACTAACCCAAACACCAACAAAAACACACTAA
JMFF022L19+ ATGGGTTTTCGTGCAATGCTGCGCCACCCACTAACCCAAACACCAACAAAAACACACTAA
JMFF043I24+ ATGGGTTTTCGTGCAATGCTGCGCCACCCACTAACCCAAACACCAACAAAAACACACTAA
JMFF050B16+ ATGGGTTTTCGTGCAATGCTGCGCCACCCACTAACCCAAACACCAACAAAAACACACTAA
                      ____________________________________________________________
consensus ATGGGTTTTCGTGCAATGCTGCGCCACCCACTAACCCAAACACCAACAAAAACACACTAA
 
. : . : . : . : . : . :
JMFF044B06+ AACACAACAGCTTGCTCAGGCCAAAGATCTGAGCATCCATGGCCGCTCGCTGTAGATTAA
JMFF051H13+ AACACAACAGCTTGCTCAGGCCAAAGATCTGAGCATCCATGGCCGCTCGCTGTAGATTAA
JMFF051H12+ AACACAACAGCTTGCTCAGGCCAAAGATCTGAGCATCCATGGCCGCTCGCTGTAGATTAA
JMFF022L19+ AACACAACAGCTTGCTCAGGCCAAAGATCTGAGCATCCATGGCCGCTCGCTGTAGATTAA
JMFF043I24+ AACACAACAGCTTGCTCAGGCCAAAGATCTGAGCATCCATGGCCGCTCGCTGTAGATTAA
JMFF050B16+ AACACAACAGCTTGCTCAGGCCAAAGATCTGAGCATCCATGGCCGCTCGCTGTAGATTAA
                      ____________________________________________________________
consensus AACACAACAGCTTGCTCAGGCCAAAGATCTGAGCATCCATGGCCGCTCGCTGTAGATTAA
 
. : . : . : . : . : . :
JMFF044B06+ TTGATTGCAGATTTGCACAACACCACACTACT
JMFF051H13+ TTGATTGCAGATTTGCACAACACCACACTACTCTCT
JMFF051H12+ TTGATTGCAGATTTGCACAACACCACACTACTCTCT
JMFF022L19+ TTGATTGCAGATTTGCACAACACCACACT
JMFF043I24+ TTGATTGCAGATTTGCACAACACCACACTACTCTCT
JMFF050B16+ TTGATTGCAGATTTGCACAACACCACACTACTCTCTATCTCTCTCTCTCTCTTTCTCTCT
                      ____________________________________________________________
consensus TTGATTGCAGATTTGCACAACACCACACTACTCTCTATCTCTCTCTCTCTCTTTCTCTCT
 
. : . : . : . : . : . :
JMFF050B16+ TTAATATGGTGTGGGATAATGGGGAAGAAGAGCTGTATGTGTGGCAATTTGGTTGTATCC
                      ____________________________________________________________
consensus TTAATATGGTGTGGGATAATGGGGAAGAAGAGCTGTATGTGTGGCAATTTGGTTGTATCC